Incidental Mutation 'R8485:Plat'
ID657682
Institutional Source Beutler Lab
Gene Symbol Plat
Ensembl Gene ENSMUSG00000031538
Gene Nameplasminogen activator, tissue
Synonymst-PA, D8Ertd2e, tPA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8485 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22757727-22782844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22772232 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 91 (G91W)
Ref Sequence ENSEMBL: ENSMUSP00000033941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033941]
Predicted Effect probably damaging
Transcript: ENSMUST00000033941
AA Change: G91W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: G91W

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FN1 38 80 5.69e-15 SMART
EGF 82 117 4.92e-5 SMART
KR 122 207 3.77e-33 SMART
KR 211 296 4.39e-34 SMART
Tryp_SPc 308 553 6.59e-84 SMART
Meta Mutation Damage Score 0.8810 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 A G 3: 97,158,986 probably benign Het
Adamts16 T C 13: 70,738,675 T999A possibly damaging Het
Adgrb1 A C 15: 74,548,304 T829P probably damaging Het
Ankrd12 C T 17: 65,983,716 S1574N probably benign Het
Ankrd2 G A 19: 42,041,945 probably null Het
Ano3 T A 2: 110,667,855 probably null Het
Arhgap18 T C 10: 26,846,108 I25T probably benign Het
Armc3 T C 2: 19,293,134 F572S probably damaging Het
Aspdh G T 7: 44,467,669 G165W probably damaging Het
Btnl10 G T 11: 58,920,316 R155L possibly damaging Het
Cacng7 A G 7: 3,366,025 E168G probably benign Het
Cadps G A 14: 12,439,872 T1215M probably damaging Het
Cbfa2t3 C A 8: 122,630,778 G598C probably damaging Het
Cdh15 T C 8: 122,857,366 S69P probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Dlec1 T G 9: 119,128,591 V881G probably benign Het
Dnah7c A C 1: 46,680,792 D2801A probably benign Het
Efhc1 T C 1: 20,960,236 M131T possibly damaging Het
Ercc2 G A 7: 19,388,240 V386I possibly damaging Het
Exoc4 T A 6: 33,921,501 I885N probably damaging Het
Fbxl22 C T 9: 66,514,567 probably null Het
Flii G T 11: 60,716,237 A971E probably benign Het
Fnip2 T A 3: 79,481,537 E599V probably benign Het
Glb1l2 G A 9: 26,767,740 L453F probably benign Het
Gm49368 C T 7: 128,112,439 P624L probably damaging Het
Gpa33 T A 1: 166,164,692 D268E probably benign Het
Gpi1 A T 7: 34,219,252 probably null Het
Iqgap2 T C 13: 95,660,151 N1165S probably damaging Het
Kctd2 G T 11: 115,429,608 probably benign Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lrmp A T 6: 145,171,674 N379I probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Mycbpap A G 11: 94,511,708 L267P probably damaging Het
Mycbpap T C 11: 94,514,533 R57G probably benign Het
Myo1b A C 1: 51,779,601 L505R probably damaging Het
Nfatc2 A C 2: 168,590,092 F34V probably damaging Het
Nphs1 A G 7: 30,466,173 N655S probably damaging Het
Nsd2 A T 5: 33,882,845 I909F probably damaging Het
Olfr1130 A T 2: 87,608,257 M290L probably benign Het
Olfr884 T A 9: 38,047,957 M245K probably benign Het
Pak2 G A 16: 32,052,265 A33V probably benign Het
Phb A G 11: 95,675,229 D113G probably benign Het
Pkhd1 T A 1: 20,523,033 I1619F probably damaging Het
Pkhd1l1 A G 15: 44,560,400 I3113V probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Rai14 A G 15: 10,575,036 L612P probably damaging Het
Rapgef1 T C 2: 29,710,174 S598P probably damaging Het
Rdm1 G A 11: 101,627,990 V8I probably benign Het
Rrbp1 A G 2: 143,955,013 F1148L probably benign Het
Slc12a2 T C 18: 57,941,146 probably null Het
Slc7a8 T A 14: 54,724,807 T457S probably benign Het
Stk32a T A 18: 43,243,010 M48K possibly damaging Het
Svil T C 18: 5,064,566 S642P probably benign Het
Taok3 G A 5: 117,251,077 V516M possibly damaging Het
Ugdh T C 5: 65,427,559 I7V possibly damaging Het
Zc3h11a T A 1: 133,625,895 S504C possibly damaging Het
Zfp512 C T 5: 31,480,057 R497W probably damaging Het
Other mutations in Plat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Plat APN 8 22776828 missense probably benign 0.00
IGL01918:Plat APN 8 22780437 missense possibly damaging 0.82
IGL01998:Plat APN 8 22767147 missense probably benign 0.31
IGL02978:Plat APN 8 22776819 missense probably damaging 1.00
R0829:Plat UTSW 8 22772257 missense probably damaging 1.00
R1065:Plat UTSW 8 22776863 missense probably damaging 0.99
R2316:Plat UTSW 8 22776865 missense probably benign 0.04
R4485:Plat UTSW 8 22772212 missense probably benign 0.01
R4873:Plat UTSW 8 22768450 missense probably benign 0.03
R4875:Plat UTSW 8 22768450 missense probably benign 0.03
R4924:Plat UTSW 8 22778253 missense probably damaging 1.00
R5051:Plat UTSW 8 22773672 missense probably benign 0.01
R5062:Plat UTSW 8 22772311 missense probably benign 0.19
R5402:Plat UTSW 8 22772722 missense probably damaging 1.00
R5672:Plat UTSW 8 22773648 missense probably benign 0.40
R6306:Plat UTSW 8 22772266 missense possibly damaging 0.83
R7035:Plat UTSW 8 22772311 missense probably benign 0.32
R7154:Plat UTSW 8 22778505 missense possibly damaging 0.76
R7297:Plat UTSW 8 22775697 missense probably benign 0.12
R7432:Plat UTSW 8 22773651 missense probably damaging 0.99
R7514:Plat UTSW 8 22775642 missense probably damaging 1.00
R7679:Plat UTSW 8 22772232 missense probably damaging 1.00
R7680:Plat UTSW 8 22772232 missense probably damaging 1.00
R7742:Plat UTSW 8 22772232 missense probably damaging 1.00
R7834:Plat UTSW 8 22772232 missense probably damaging 1.00
R7885:Plat UTSW 8 22771720 missense probably benign 0.00
R7918:Plat UTSW 8 22773639 missense probably damaging 1.00
R8039:Plat UTSW 8 22772232 missense probably damaging 1.00
R8040:Plat UTSW 8 22772232 missense probably damaging 1.00
R8243:Plat UTSW 8 22772232 missense probably damaging 1.00
R8347:Plat UTSW 8 22772232 missense probably damaging 1.00
R8355:Plat UTSW 8 22771742 nonsense probably null
R8422:Plat UTSW 8 22772232 missense probably damaging 1.00
R8423:Plat UTSW 8 22772232 missense probably damaging 1.00
R8424:Plat UTSW 8 22772232 missense probably damaging 1.00
R8426:Plat UTSW 8 22772232 missense probably damaging 1.00
R8427:Plat UTSW 8 22772232 missense probably damaging 1.00
R8507:Plat UTSW 8 22772232 missense probably damaging 1.00
R8510:Plat UTSW 8 22772232 missense probably damaging 1.00
R8714:Plat UTSW 8 22772232 missense probably damaging 1.00
R8716:Plat UTSW 8 22772232 missense probably damaging 1.00
R8717:Plat UTSW 8 22772232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCATGCTTCGCGGTTGAC -3'
(R):5'- GGGCCCAATAGTGTCAAGTCTC -3'

Sequencing Primer
(F):5'- CTTCGCGGTTGACAGGGG -3'
(R):5'- GTGTCAAGTCTCTAAATGACCTCAGC -3'
Posted On2021-01-18