Incidental Mutation 'R8485:Iqgap2'
ID657698
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8485 (G1)
Quality Score168.009
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95660151 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1165 (N1165S)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: N1165S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: N1165S

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 A G 3: 97,158,986 probably benign Het
Adamts16 T C 13: 70,738,675 T999A possibly damaging Het
Adgrb1 A C 15: 74,548,304 T829P probably damaging Het
Ankrd12 C T 17: 65,983,716 S1574N probably benign Het
Ankrd2 G A 19: 42,041,945 probably null Het
Ano3 T A 2: 110,667,855 probably null Het
Arhgap18 T C 10: 26,846,108 I25T probably benign Het
Armc3 T C 2: 19,293,134 F572S probably damaging Het
Aspdh G T 7: 44,467,669 G165W probably damaging Het
Btnl10 G T 11: 58,920,316 R155L possibly damaging Het
Cacng7 A G 7: 3,366,025 E168G probably benign Het
Cadps G A 14: 12,439,872 T1215M probably damaging Het
Cbfa2t3 C A 8: 122,630,778 G598C probably damaging Het
Cdh15 T C 8: 122,857,366 S69P probably damaging Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Dlec1 T G 9: 119,128,591 V881G probably benign Het
Dnah7c A C 1: 46,680,792 D2801A probably benign Het
Efhc1 T C 1: 20,960,236 M131T possibly damaging Het
Ercc2 G A 7: 19,388,240 V386I possibly damaging Het
Exoc4 T A 6: 33,921,501 I885N probably damaging Het
Fbxl22 C T 9: 66,514,567 probably null Het
Flii G T 11: 60,716,237 A971E probably benign Het
Fnip2 T A 3: 79,481,537 E599V probably benign Het
Glb1l2 G A 9: 26,767,740 L453F probably benign Het
Gm49368 C T 7: 128,112,439 P624L probably damaging Het
Gpa33 T A 1: 166,164,692 D268E probably benign Het
Gpi1 A T 7: 34,219,252 probably null Het
Kctd2 G T 11: 115,429,608 probably benign Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lrmp A T 6: 145,171,674 N379I probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Mycbpap A G 11: 94,511,708 L267P probably damaging Het
Mycbpap T C 11: 94,514,533 R57G probably benign Het
Myo1b A C 1: 51,779,601 L505R probably damaging Het
Nfatc2 A C 2: 168,590,092 F34V probably damaging Het
Nphs1 A G 7: 30,466,173 N655S probably damaging Het
Nsd2 A T 5: 33,882,845 I909F probably damaging Het
Olfr1130 A T 2: 87,608,257 M290L probably benign Het
Olfr884 T A 9: 38,047,957 M245K probably benign Het
Pak2 G A 16: 32,052,265 A33V probably benign Het
Phb A G 11: 95,675,229 D113G probably benign Het
Pkhd1 T A 1: 20,523,033 I1619F probably damaging Het
Pkhd1l1 A G 15: 44,560,400 I3113V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Rai14 A G 15: 10,575,036 L612P probably damaging Het
Rapgef1 T C 2: 29,710,174 S598P probably damaging Het
Rdm1 G A 11: 101,627,990 V8I probably benign Het
Rrbp1 A G 2: 143,955,013 F1148L probably benign Het
Slc12a2 T C 18: 57,941,146 probably null Het
Slc7a8 T A 14: 54,724,807 T457S probably benign Het
Stk32a T A 18: 43,243,010 M48K possibly damaging Het
Svil T C 18: 5,064,566 S642P probably benign Het
Taok3 G A 5: 117,251,077 V516M possibly damaging Het
Ugdh T C 5: 65,427,559 I7V possibly damaging Het
Zc3h11a T A 1: 133,625,895 S504C possibly damaging Het
Zfp512 C T 5: 31,480,057 R497W probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCTGGGAACATCTTGTCTG -3'
(R):5'- TGTGCAGATTGTTGGAAATCTC -3'

Sequencing Primer
(F):5'- GTTCCTTTCCTTCATTATCCAGGG -3'
(R):5'- GTTGGAAATCTCCTATACTACCGG -3'
Posted On2021-01-18