Incidental Mutation 'R8485:Slc12a2'
ID657710
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Namesolute carrier family 12, member 2
SynonymsNkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8485 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location57878678-57946821 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 57941146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
Predicted Effect probably null
Transcript: ENSMUST00000115366
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 A G 3: 97,158,986 probably benign Het
Adamts16 T C 13: 70,738,675 T999A possibly damaging Het
Adgrb1 A C 15: 74,548,304 T829P probably damaging Het
Ankrd12 C T 17: 65,983,716 S1574N probably benign Het
Ankrd2 G A 19: 42,041,945 probably null Het
Ano3 T A 2: 110,667,855 probably null Het
Arhgap18 T C 10: 26,846,108 I25T probably benign Het
Armc3 T C 2: 19,293,134 F572S probably damaging Het
Aspdh G T 7: 44,467,669 G165W probably damaging Het
Btnl10 G T 11: 58,920,316 R155L possibly damaging Het
Cacng7 A G 7: 3,366,025 E168G probably benign Het
Cadps G A 14: 12,439,872 T1215M probably damaging Het
Cbfa2t3 C A 8: 122,630,778 G598C probably damaging Het
Cdh15 T C 8: 122,857,366 S69P probably damaging Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Dlec1 T G 9: 119,128,591 V881G probably benign Het
Dnah7c A C 1: 46,680,792 D2801A probably benign Het
Efhc1 T C 1: 20,960,236 M131T possibly damaging Het
Ercc2 G A 7: 19,388,240 V386I possibly damaging Het
Exoc4 T A 6: 33,921,501 I885N probably damaging Het
Fbxl22 C T 9: 66,514,567 probably null Het
Flii G T 11: 60,716,237 A971E probably benign Het
Fnip2 T A 3: 79,481,537 E599V probably benign Het
Glb1l2 G A 9: 26,767,740 L453F probably benign Het
Gm49368 C T 7: 128,112,439 P624L probably damaging Het
Gpa33 T A 1: 166,164,692 D268E probably benign Het
Gpi1 A T 7: 34,219,252 probably null Het
Iqgap2 T C 13: 95,660,151 N1165S probably damaging Het
Kctd2 G T 11: 115,429,608 probably benign Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lrmp A T 6: 145,171,674 N379I probably damaging Het
Lrp1 G A 10: 127,558,650 R2565C probably damaging Het
Mycbpap A G 11: 94,511,708 L267P probably damaging Het
Mycbpap T C 11: 94,514,533 R57G probably benign Het
Myo1b A C 1: 51,779,601 L505R probably damaging Het
Nfatc2 A C 2: 168,590,092 F34V probably damaging Het
Nphs1 A G 7: 30,466,173 N655S probably damaging Het
Nsd2 A T 5: 33,882,845 I909F probably damaging Het
Olfr1130 A T 2: 87,608,257 M290L probably benign Het
Olfr884 T A 9: 38,047,957 M245K probably benign Het
Pak2 G A 16: 32,052,265 A33V probably benign Het
Phb A G 11: 95,675,229 D113G probably benign Het
Pkhd1 T A 1: 20,523,033 I1619F probably damaging Het
Pkhd1l1 A G 15: 44,560,400 I3113V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Rai14 A G 15: 10,575,036 L612P probably damaging Het
Rapgef1 T C 2: 29,710,174 S598P probably damaging Het
Rdm1 G A 11: 101,627,990 V8I probably benign Het
Rrbp1 A G 2: 143,955,013 F1148L probably benign Het
Slc7a8 T A 14: 54,724,807 T457S probably benign Het
Stk32a T A 18: 43,243,010 M48K possibly damaging Het
Svil T C 18: 5,064,566 S642P probably benign Het
Taok3 G A 5: 117,251,077 V516M possibly damaging Het
Ugdh T C 5: 65,427,559 I7V possibly damaging Het
Zc3h11a T A 1: 133,625,895 S504C possibly damaging Het
Zfp512 C T 5: 31,480,057 R497W probably damaging Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 57900050 missense probably benign 0.03
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 57910256 missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 57912965 splice site probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 57896354 missense probably benign 0.01
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
R7411:Slc12a2 UTSW 18 57941013 missense probably benign 0.01
R7508:Slc12a2 UTSW 18 57904393 missense probably benign 0.01
R7645:Slc12a2 UTSW 18 57896378 missense possibly damaging 0.94
R7658:Slc12a2 UTSW 18 57932524 missense probably benign 0.02
R8054:Slc12a2 UTSW 18 57921872 nonsense probably null
R8093:Slc12a2 UTSW 18 57879351 missense probably benign 0.17
R8099:Slc12a2 UTSW 18 57899392 missense probably damaging 0.99
R8121:Slc12a2 UTSW 18 57899331 missense probably benign 0.44
R8214:Slc12a2 UTSW 18 57937719 missense probably benign 0.29
R8273:Slc12a2 UTSW 18 57914266 splice site probably benign
R8341:Slc12a2 UTSW 18 57879209 missense possibly damaging 0.48
R8797:Slc12a2 UTSW 18 57879383 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTGAGAGCTTGGGAATTACCGC -3'
(R):5'- GTATGCCCATGTAGCTATGGG -3'

Sequencing Primer
(F):5'- AGAGCTTGGGAATTACCGCTTTTTAC -3'
(R):5'- GGGCTAGATCTTTAGCACTACCAAAG -3'
Posted On2021-01-18