Incidental Mutation 'R8486:Olfr656'
ID657741
Institutional Source Beutler Lab
Gene Symbol Olfr656
Ensembl Gene ENSMUSG00000073924
Gene Nameolfactory receptor 656
SynonymsGA_x6K02T2PBJ9-7245486-7246451, MOR27-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8486 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104613955-104621603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104617862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000095774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098172
AA Change: V69A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: V69A

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215575
AA Change: V61A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,275,092 S524G probably benign Het
Abca8b A T 11: 109,967,111 I546N possibly damaging Het
Abcd4 C T 12: 84,603,978 R532H probably damaging Het
Acsf2 A T 11: 94,569,960 D373E probably damaging Het
Acsm1 A G 7: 119,660,657 T510A probably damaging Het
Adam21 C T 12: 81,560,776 V71I probably benign Het
Adgra3 T C 5: 49,990,279 D473G probably damaging Het
Agbl2 G A 2: 90,801,155 V286I possibly damaging Het
Alkbh8 A G 9: 3,344,642 E141G probably null Het
Arhgap21 T C 2: 20,860,425 D952G probably damaging Het
Asb4 A T 6: 5,390,653 K15N possibly damaging Het
Atp2b4 CTTCTT CTTCTTTTTCTT 1: 133,701,744 probably benign Het
Clip1 G T 5: 123,614,707 probably benign Het
Clip4 T C 17: 71,863,844 probably benign Het
Col4a3bp T C 13: 96,634,182 V533A probably damaging Het
Cyp2b10 T C 7: 25,914,881 V260A probably benign Het
Dnm1 C T 2: 32,334,727 M430I probably benign Het
Dpp7 T C 2: 25,352,549 D464G probably damaging Het
Dspp A G 5: 104,174,017 probably benign Het
Ephb1 A C 9: 101,963,965 D730E probably benign Het
Fancf A G 7: 51,861,884 V124A probably benign Het
Fgfr2 G A 7: 130,164,015 P692S possibly damaging Het
Fkbp15 G A 4: 62,312,284 R731* probably null Het
Fos T C 12: 85,476,031 F239S probably benign Het
Fuz T C 7: 44,898,668 Y107H probably damaging Het
Gm3159 A C 14: 4,400,520 N193T probably damaging Het
Helz2 T A 2: 181,229,331 D2771V probably damaging Het
Ighv1-18 T A 12: 114,682,705 K92M probably damaging Het
Kcnh3 A G 15: 99,238,210 Y696C probably damaging Het
Klf15 T A 6: 90,467,178 V245D probably damaging Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lamc2 A G 1: 153,158,891 M122T probably benign Het
Lrp1b A G 2: 41,728,690 L124P probably damaging Het
Mcrs1 G T 15: 99,248,468 Y85* probably null Het
Mgst1 A T 6: 138,143,028 I29L probably benign Het
Miga1 C T 3: 152,276,753 R562H probably damaging Het
Mybpc3 T C 2: 91,128,772 W687R probably damaging Het
Myh11 G T 16: 14,204,668 A1682D possibly damaging Het
Nes T C 3: 87,980,013 S1816P probably damaging Het
Olfr368 T G 2: 37,332,650 V301G probably damaging Het
Pkhd1l1 T G 15: 44,547,416 F2773C probably damaging Het
Pkp1 C G 1: 135,918,976 E13Q probably damaging Het
Ppp2r2b T C 18: 42,898,804 D4G probably benign Het
Ppp6r3 G A 19: 3,487,072 H455Y probably benign Het
R3hdm1 A G 1: 128,178,920 R202G probably benign Het
Sgcz T G 8: 37,723,053 K106N probably benign Het
Slc13a4 T C 6: 35,270,369 Y572C probably damaging Het
Syne2 C T 12: 76,042,107 Q5080* probably null Het
Tpst2 C T 5: 112,308,305 Q5* probably null Het
Ttn T A 2: 76,731,533 T28908S possibly damaging Het
Vmn1r120 C T 7: 21,053,102 R228H probably benign Het
Vmn2r3 T C 3: 64,278,949 N105S probably damaging Het
Zfp521 T C 18: 13,846,772 T195A probably damaging Het
Zfp616 T A 11: 74,084,083 S484T probably benign Het
Other mutations in Olfr656
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Olfr656 APN 7 104617721 missense probably damaging 0.98
IGL01908:Olfr656 APN 7 104617699 missense probably damaging 1.00
IGL02695:Olfr656 APN 7 104618471 missense probably damaging 1.00
IGL03055:Olfr656 UTSW 7 104618206 missense probably damaging 1.00
R0128:Olfr656 UTSW 7 104618581 missense probably damaging 1.00
R0184:Olfr656 UTSW 7 104618240 missense probably damaging 1.00
R4674:Olfr656 UTSW 7 104618424 nonsense probably null
R4675:Olfr656 UTSW 7 104618424 nonsense probably null
R4723:Olfr656 UTSW 7 104618489 missense possibly damaging 0.56
R4979:Olfr656 UTSW 7 104618605 missense probably null 0.03
R6273:Olfr656 UTSW 7 104617895 missense probably damaging 1.00
R6359:Olfr656 UTSW 7 104618303 missense probably damaging 1.00
R6582:Olfr656 UTSW 7 104618441 missense probably damaging 1.00
R6750:Olfr656 UTSW 7 104618113 missense probably damaging 0.99
R7426:Olfr656 UTSW 7 104617852 missense probably damaging 1.00
R7786:Olfr656 UTSW 7 104617718 missense probably benign 0.02
R8068:Olfr656 UTSW 7 104618253 nonsense probably null
R8324:Olfr656 UTSW 7 104618114 missense probably benign 0.00
X0065:Olfr656 UTSW 7 104617758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGATTTTCTGACCAGAGAC -3'
(R):5'- ACAGCACTGTGGACTCCATC -3'

Sequencing Primer
(F):5'- GGATTTTCTGACCAGAGACTATGTCC -3'
(R):5'- CTGTGGACTCCATCATGCAAAAGG -3'
Posted On2021-01-18