Incidental Mutation 'R8486:Ighv1-18'
ID657755
Institutional Source Beutler Lab
Gene Symbol Ighv1-18
Ensembl Gene ENSMUSG00000076695
Gene Nameimmunoglobulin heavy variable V1-18
SynonymsGm16856
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8486 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location114682632-114683065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114682705 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 92 (K92M)
Ref Sequence ENSEMBL: ENSMUSP00000100285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103504] [ENSMUST00000194350]
Predicted Effect probably damaging
Transcript: ENSMUST00000103504
AA Change: K92M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100285
Gene: ENSMUSG00000076695
AA Change: K92M

DomainStartEndE-ValueType
Pfam:V-set 18 102 9.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194350
AA Change: K93M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142064
Gene: ENSMUSG00000076695
AA Change: K93M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 2.4e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,275,092 S524G probably benign Het
Abca8b A T 11: 109,967,111 I546N possibly damaging Het
Abcd4 C T 12: 84,603,978 R532H probably damaging Het
Acsf2 A T 11: 94,569,960 D373E probably damaging Het
Acsm1 A G 7: 119,660,657 T510A probably damaging Het
Adam21 C T 12: 81,560,776 V71I probably benign Het
Adgra3 T C 5: 49,990,279 D473G probably damaging Het
Agbl2 G A 2: 90,801,155 V286I possibly damaging Het
Alkbh8 A G 9: 3,344,642 E141G probably null Het
Arhgap21 T C 2: 20,860,425 D952G probably damaging Het
Asb4 A T 6: 5,390,653 K15N possibly damaging Het
Clip1 G T 5: 123,614,707 probably benign Het
Clip4 T C 17: 71,863,844 probably benign Het
Col4a3bp T C 13: 96,634,182 V533A probably damaging Het
Cyp2b10 T C 7: 25,914,881 V260A probably benign Het
Dnm1 C T 2: 32,334,727 M430I probably benign Het
Dpp7 T C 2: 25,352,549 D464G probably damaging Het
Dspp A G 5: 104,174,017 probably benign Het
Ephb1 A C 9: 101,963,965 D730E probably benign Het
Fancf A G 7: 51,861,884 V124A probably benign Het
Fgfr2 G A 7: 130,164,015 P692S possibly damaging Het
Fkbp15 G A 4: 62,312,284 R731* probably null Het
Fos T C 12: 85,476,031 F239S probably benign Het
Fuz T C 7: 44,898,668 Y107H probably damaging Het
Gm3159 A C 14: 4,400,520 N193T probably damaging Het
Helz2 T A 2: 181,229,331 D2771V probably damaging Het
Kcnh3 A G 15: 99,238,210 Y696C probably damaging Het
Klf15 T A 6: 90,467,178 V245D probably damaging Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lamc2 A G 1: 153,158,891 M122T probably benign Het
Lrp1b A G 2: 41,728,690 L124P probably damaging Het
Mcrs1 G T 15: 99,248,468 Y85* probably null Het
Mgst1 A T 6: 138,143,028 I29L probably benign Het
Miga1 C T 3: 152,276,753 R562H probably damaging Het
Mybpc3 T C 2: 91,128,772 W687R probably damaging Het
Myh11 G T 16: 14,204,668 A1682D possibly damaging Het
Nes T C 3: 87,980,013 S1816P probably damaging Het
Olfr368 T G 2: 37,332,650 V301G probably damaging Het
Olfr656 T C 7: 104,617,862 V69A possibly damaging Het
Pkhd1l1 T G 15: 44,547,416 F2773C probably damaging Het
Pkp1 C G 1: 135,918,976 E13Q probably damaging Het
Ppp2r2b T C 18: 42,898,804 D4G probably benign Het
Ppp6r3 G A 19: 3,487,072 H455Y probably benign Het
R3hdm1 A G 1: 128,178,920 R202G probably benign Het
Sgcz T G 8: 37,723,053 K106N probably benign Het
Slc13a4 T C 6: 35,270,369 Y572C probably damaging Het
Syne2 C T 12: 76,042,107 Q5080* probably null Het
Tpst2 C T 5: 112,308,305 Q5* probably null Het
Ttn T A 2: 76,731,533 T28908S possibly damaging Het
Vmn1r120 C T 7: 21,053,102 R228H probably benign Het
Vmn2r3 T C 3: 64,278,949 N105S probably damaging Het
Zfp521 T C 18: 13,846,772 T195A probably damaging Het
Zfp616 T A 11: 74,084,083 S484T probably benign Het
Other mutations in Ighv1-18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03269:Ighv1-18 APN 12 114682846 missense probably damaging 1.00
R4056:Ighv1-18 UTSW 12 114682667 missense probably benign 0.26
R5766:Ighv1-18 UTSW 12 114682907 missense probably damaging 1.00
R5801:Ighv1-18 UTSW 12 114682708 missense probably damaging 1.00
R6387:Ighv1-18 UTSW 12 114682660 missense probably damaging 0.98
R6981:Ighv1-18 UTSW 12 114682678 missense probably damaging 1.00
R7703:Ighv1-18 UTSW 12 114682761 missense probably benign 0.23
R7974:Ighv1-18 UTSW 12 114683049 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATGACTGCATCTAAGCAAGTCTG -3'
(R):5'- TGCAACAGTCTGGACCTGAG -3'

Sequencing Primer
(F):5'- AAGTCTGCAAGCGACTCTTCTCTAAG -3'
(R):5'- CCTGGGGCTTCAGTGAAGATAC -3'
Posted On2021-01-18