Incidental Mutation 'R8486:Ppp2r2b'
ID657764
Institutional Source Beutler Lab
Gene Symbol Ppp2r2b
Ensembl Gene ENSMUSG00000024500
Gene Nameprotein phosphatase 2, regulatory subunit B, beta
SynonymsSCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8486 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location42637432-43059471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42898804 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 4 (D4G)
Ref Sequence ENSEMBL: ENSMUSP00000113411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025377] [ENSMUST00000117687] [ENSMUST00000120632]
Predicted Effect probably benign
Transcript: ENSMUST00000025377
SMART Domains Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500

DomainStartEndE-ValueType
WD40 14 55 6.42e-1 SMART
WD40 82 122 3.7e0 SMART
WD40 164 203 1.66e0 SMART
WD40 214 254 1.38e1 SMART
WD40 273 311 5.7e1 SMART
Blast:WD40 315 369 6e-26 BLAST
WD40 405 442 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117687
AA Change: D4G

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113731
Gene: ENSMUSG00000024500
AA Change: D4G

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120632
AA Change: D4G

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113411
Gene: ENSMUSG00000024500
AA Change: D4G

DomainStartEndE-ValueType
WD40 13 52 1.92e0 SMART
WD40 79 119 3.7e0 SMART
WD40 161 200 1.66e0 SMART
WD40 211 251 1.38e1 SMART
WD40 270 308 5.7e1 SMART
Blast:WD40 312 366 4e-26 BLAST
WD40 402 439 1.33e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,275,092 S524G probably benign Het
Abca8b A T 11: 109,967,111 I546N possibly damaging Het
Abcd4 C T 12: 84,603,978 R532H probably damaging Het
Acsf2 A T 11: 94,569,960 D373E probably damaging Het
Acsm1 A G 7: 119,660,657 T510A probably damaging Het
Adam21 C T 12: 81,560,776 V71I probably benign Het
Adgra3 T C 5: 49,990,279 D473G probably damaging Het
Agbl2 G A 2: 90,801,155 V286I possibly damaging Het
Alkbh8 A G 9: 3,344,642 E141G probably null Het
Arhgap21 T C 2: 20,860,425 D952G probably damaging Het
Asb4 A T 6: 5,390,653 K15N possibly damaging Het
Clip1 G T 5: 123,614,707 probably benign Het
Clip4 T C 17: 71,863,844 probably benign Het
Col4a3bp T C 13: 96,634,182 V533A probably damaging Het
Cyp2b10 T C 7: 25,914,881 V260A probably benign Het
Dnm1 C T 2: 32,334,727 M430I probably benign Het
Dpp7 T C 2: 25,352,549 D464G probably damaging Het
Dspp A G 5: 104,174,017 probably benign Het
Ephb1 A C 9: 101,963,965 D730E probably benign Het
Fancf A G 7: 51,861,884 V124A probably benign Het
Fgfr2 G A 7: 130,164,015 P692S possibly damaging Het
Fkbp15 G A 4: 62,312,284 R731* probably null Het
Fos T C 12: 85,476,031 F239S probably benign Het
Fuz T C 7: 44,898,668 Y107H probably damaging Het
Gm3159 A C 14: 4,400,520 N193T probably damaging Het
Helz2 T A 2: 181,229,331 D2771V probably damaging Het
Ighv1-18 T A 12: 114,682,705 K92M probably damaging Het
Kcnh3 A G 15: 99,238,210 Y696C probably damaging Het
Klf15 T A 6: 90,467,178 V245D probably damaging Het
L1td1 C T 4: 98,737,674 A702V probably damaging Het
Lamc2 A G 1: 153,158,891 M122T probably benign Het
Lrp1b A G 2: 41,728,690 L124P probably damaging Het
Mcrs1 G T 15: 99,248,468 Y85* probably null Het
Mgst1 A T 6: 138,143,028 I29L probably benign Het
Miga1 C T 3: 152,276,753 R562H probably damaging Het
Mybpc3 T C 2: 91,128,772 W687R probably damaging Het
Myh11 G T 16: 14,204,668 A1682D possibly damaging Het
Nes T C 3: 87,980,013 S1816P probably damaging Het
Olfr368 T G 2: 37,332,650 V301G probably damaging Het
Olfr656 T C 7: 104,617,862 V69A possibly damaging Het
Pkhd1l1 T G 15: 44,547,416 F2773C probably damaging Het
Pkp1 C G 1: 135,918,976 E13Q probably damaging Het
Ppp6r3 G A 19: 3,487,072 H455Y probably benign Het
R3hdm1 A G 1: 128,178,920 R202G probably benign Het
Sgcz T G 8: 37,723,053 K106N probably benign Het
Slc13a4 T C 6: 35,270,369 Y572C probably damaging Het
Syne2 C T 12: 76,042,107 Q5080* probably null Het
Tpst2 C T 5: 112,308,305 Q5* probably null Het
Ttn T A 2: 76,731,533 T28908S possibly damaging Het
Vmn1r120 C T 7: 21,053,102 R228H probably benign Het
Vmn2r3 T C 3: 64,278,949 N105S probably damaging Het
Zfp521 T C 18: 13,846,772 T195A probably damaging Het
Zfp616 T A 11: 74,084,083 S484T probably benign Het
Other mutations in Ppp2r2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ppp2r2b APN 18 42645775 missense probably damaging 0.99
IGL01999:Ppp2r2b APN 18 42645723 utr 3 prime probably benign
IGL02610:Ppp2r2b APN 18 42648775 splice site probably benign
IGL02733:Ppp2r2b APN 18 42648728 missense possibly damaging 0.96
IGL02899:Ppp2r2b APN 18 42645809 missense probably damaging 1.00
Degradation UTSW 18 42688338 missense probably benign 0.27
R0737:Ppp2r2b UTSW 18 43059192 missense probably benign
R1459:Ppp2r2b UTSW 18 42737990 missense probably damaging 1.00
R1616:Ppp2r2b UTSW 18 42688310 missense probably benign 0.32
R1635:Ppp2r2b UTSW 18 43059210 missense probably benign 0.01
R3435:Ppp2r2b UTSW 18 42741109 missense possibly damaging 0.48
R4204:Ppp2r2b UTSW 18 42738050 missense probably benign
R4301:Ppp2r2b UTSW 18 42898746 missense probably null
R5062:Ppp2r2b UTSW 18 42688461 missense possibly damaging 0.48
R5147:Ppp2r2b UTSW 18 42645877 missense probably benign 0.00
R5207:Ppp2r2b UTSW 18 42688352 missense probably damaging 1.00
R5277:Ppp2r2b UTSW 18 42741142 missense probably damaging 1.00
R6004:Ppp2r2b UTSW 18 43059159 splice site probably null
R6528:Ppp2r2b UTSW 18 42688338 missense probably benign 0.27
R6735:Ppp2r2b UTSW 18 42688588 splice site probably null
R7521:Ppp2r2b UTSW 18 43059177 missense probably benign
R7831:Ppp2r2b UTSW 18 42701532 missense probably benign
R8405:Ppp2r2b UTSW 18 42645740 missense probably benign 0.00
Z1177:Ppp2r2b UTSW 18 42648693 missense probably benign 0.04
Z1177:Ppp2r2b UTSW 18 42688423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCTGGAGTAGTCTCTG -3'
(R):5'- ATCCTCGTTGGGAATTGGAG -3'

Sequencing Primer
(F):5'- CTGGAGTAGTCTCTGCCACTAG -3'
(R):5'- AGGTGACAGCTCCATTGC -3'
Posted On2021-01-18