Mutagenetix > Incidental Mutation

Incidental Mutation 'R8487:Tchhl1'

657777

Institutional Source

Beutler Lab

Gene Symbol

Tchhl1

Ensembl Gene

ENSMUSG00000027908

Gene Name

trichohyalin-like 1

Synonyms

Thhl1, S100a17

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93468754-93471980 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93469562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 22 (D22G)

Ref Sequence

ENSEMBL: ENSMUSP00000029516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029516]

AlphaFold

Q9D3P1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029516
AA Change: D22G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: D22G

Domain	Start	End	E-Value	Type
Pfam:S_100	4	47	1.2e-15	PFAM
low complexity region	111	124	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,859,486	I153V	probably benign	Het
Arhgap21	A	C	2: 20,881,305	S354A	probably benign	Het
Bcan	T	C	3: 87,989,209	T727A	probably damaging	Het
Brinp1	C	T	4: 68,829,455	G137E	probably damaging	Het
Catsperd	A	G	17: 56,663,419	Y697C	probably damaging	Het
Ccdc39	T	A	3: 33,832,659	K267*	probably null	Het
Ccdc47	C	A	11: 106,202,145	V92L	possibly damaging	Het
Cyp2c54	A	T	19: 40,071,546	I181N	probably damaging	Het
Ddx60	A	T	8: 61,974,150	D753V	probably damaging	Het
Dlg2	A	T	7: 92,286,588	K641N	probably damaging	Het
Eloa	G	A	4: 136,009,357	R527C	probably benign	Het
Fancd2	C	T	6: 113,568,226	P835L	probably damaging	Het
Fbln2	C	G	6: 91,250,864	T428S	probably damaging	Het
Fbn2	G	A	18: 58,020,390	A2600V	possibly damaging	Het
Gbe1	A	G	16: 70,436,988	Y251C	probably damaging	Het
Gnptab	T	A	10: 88,432,646		probably null	Het
Hspa1a	T	A	17: 34,972,057		probably benign	Het
Ifi204	G	A	1: 173,760,273	P107S	probably damaging	Het
Kif6	A	G	17: 49,671,136	I119V	probably damaging	Het
Lmntd2	G	A	7: 141,210,514	H554Y	probably benign	Het
Lrrc8e	C	A	8: 4,234,218	H148N	probably damaging	Het
Lrriq1	T	C	10: 103,215,053	N613D	probably damaging	Het
Map4k4	C	T	1: 39,988,976	T319M	probably damaging	Het
Mbtps1	C	T	8: 119,541,674	V253I	probably damaging	Het
Mcm4	C	A	16: 15,632,178	C330F	probably damaging	Het
Mok	A	G	12: 110,809,907		probably null	Het
Nedd4	T	C	9: 72,670,039	C49R	probably damaging	Het
Nlrp4e	T	C	7: 23,321,558	V490A	probably benign	Het
Nsf	A	T	11: 103,928,758	F27I	probably damaging	Het
Olfr1256	T	C	2: 89,835,265	N227D	probably benign	Het
Olfr1513	A	T	14: 52,349,239	L269Q	probably damaging	Het
Olfr301	A	G	7: 86,412,439	S26G	probably benign	Het
Olfr498	G	T	7: 108,465,577	M84I	possibly damaging	Het
Olfr798	A	G	10: 129,625,245	I272T	possibly damaging	Het
Pax1	A	G	2: 147,365,048	M1V	probably null	Het
Pcdhga12	A	G	18: 37,767,578	T488A	probably damaging	Het
Plekhh2	A	G	17: 84,557,481	D99G	possibly damaging	Het
Polr3h	T	C	15: 81,916,623	T173A	probably benign	Het
Pramel6	C	T	2: 87,508,701	L82F	probably damaging	Het
Ralgapa2	A	T	2: 146,388,543	I1034N	probably damaging	Het
Rbfox1	G	A	16: 7,224,455	V58I	probably damaging	Het
Reln	T	A	5: 21,899,029	I3315L	probably benign	Het
Rev3l	T	A	10: 39,806,848	S321T	probably damaging	Het
Ryr1	T	C	7: 29,040,867	T3908A	probably damaging	Het
Secisbp2l	G	T	2: 125,775,582	Y58*	probably null	Het
Sgms1	C	A	19: 32,125,297	V337L	probably benign	Het
Slc38a2	G	A	15: 96,695,291	Q136*	probably null	Het
Smarcd1	T	A	15: 99,707,776	V296D	probably damaging	Het
Smcr8	A	C	11: 60,783,996	H866P	probably damaging	Het
Spcs1	T	A	14: 31,000,764	I33L	probably benign	Het
Stxbp5	T	C	10: 9,812,289	R423G	possibly damaging	Het
Syt4	A	T	18: 31,443,737	M188K	possibly damaging	Het
Tiparp	T	A	3: 65,546,234	N134K	probably benign	Het
Topaz1	A	G	9: 122,749,936	D637G	possibly damaging	Het
Trav14d-3-dv8	A	T	14: 53,078,735		probably benign	Het
Vmn1r19	A	T	6: 57,405,181	M240L	probably benign	Het
Vmn1r77	T	A	7: 12,041,587	S29T	probably damaging	Het
Vps13d	A	G	4: 145,155,247	F1253L	probably benign	Het
Zfp407	G	A	18: 84,562,770	R73*	probably null	Het
Zfp446	T	A	7: 12,982,628	F334I	possibly damaging	Het
Zfp654	A	T	16: 64,785,648	Y730*	probably null	Het

Other mutations in Tchhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Tchhl1	APN	3	93470923	missense	probably benign	0.00
IGL00803:Tchhl1	APN	3	93470900	missense	probably benign	0.00
IGL01075:Tchhl1	APN	3	93470316	missense	probably damaging	1.00
IGL01814:Tchhl1	APN	3	93470349	missense	possibly damaging	0.53
IGL02026:Tchhl1	APN	3	93470555	missense	probably damaging	0.99
IGL02407:Tchhl1	APN	3	93471327	missense	possibly damaging	0.95
IGL03286:Tchhl1	APN	3	93471123	missense	probably benign	0.00
IGL03293:Tchhl1	APN	3	93470275	missense	probably damaging	1.00
Reef	UTSW	3	93471029	nonsense	probably null
R0371:Tchhl1	UTSW	3	93469577	missense	probably damaging	1.00
R0403:Tchhl1	UTSW	3	93471029	nonsense	probably null
R0763:Tchhl1	UTSW	3	93471571	missense	probably benign	0.05
R1052:Tchhl1	UTSW	3	93470213	missense	probably benign	0.32
R1848:Tchhl1	UTSW	3	93471101	missense	probably damaging	1.00
R4917:Tchhl1	UTSW	3	93470316	missense	possibly damaging	0.52
R4918:Tchhl1	UTSW	3	93470316	missense	possibly damaging	0.52
R4945:Tchhl1	UTSW	3	93471576	missense	probably benign	0.00
R5251:Tchhl1	UTSW	3	93470553	missense	possibly damaging	0.70
R5260:Tchhl1	UTSW	3	93470795	missense	probably damaging	1.00
R5398:Tchhl1	UTSW	3	93471603	missense	probably benign	0.01
R5759:Tchhl1	UTSW	3	93471556	missense	probably damaging	1.00
R5760:Tchhl1	UTSW	3	93471556	missense	probably damaging	1.00
R5872:Tchhl1	UTSW	3	93470529	missense	probably benign	0.31
R6592:Tchhl1	UTSW	3	93470809	missense	probably damaging	0.99
R7464:Tchhl1	UTSW	3	93470664	missense	probably benign	0.01
R7653:Tchhl1	UTSW	3	93471144	missense	probably benign	0.01
R7726:Tchhl1	UTSW	3	93471758	missense	probably benign	0.07
R9207:Tchhl1	UTSW	3	93470512	missense	possibly damaging	0.94
RF018:Tchhl1	UTSW	3	93470384	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGATTCAGAGGTTTAACTCCCC -3'
(R):5'- CTGGTTAGCCAAGTGCAAAG -3'

Sequencing Primer
(F):5'- TGTTCTTGACAACACAACACATGAG -3'
(R):5'- AAGGGACAGATAGCCTTTGTGCTC -3'

Posted On

2021-01-18