Incidental Mutation 'R8487:Vmn1r19'
ID 657783
Institutional Source Beutler Lab
Gene Symbol Vmn1r19
Ensembl Gene ENSMUSG00000115799
Gene Name vomeronasal 1 receptor 19
Synonyms V1rc27
MMRRC Submission 067930-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 57381449-57382375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57382166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 240 (M240L)
Ref Sequence ENSEMBL: ENSMUSP00000087264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089830]
AlphaFold Q8R2C7
Predicted Effect probably benign
Transcript: ENSMUST00000089830
AA Change: M240L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087264
Gene: ENSMUSG00000115799
AA Change: M240L

DomainStartEndE-ValueType
Pfam:V1R 28 293 6.6e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,565,122 (GRCm39) I153V probably benign Het
Arhgap21 A C 2: 20,886,116 (GRCm39) S354A probably benign Het
Bcan T C 3: 87,896,516 (GRCm39) T727A probably damaging Het
Brinp1 C T 4: 68,747,692 (GRCm39) G137E probably damaging Het
Catsperd A G 17: 56,970,419 (GRCm39) Y697C probably damaging Het
Ccdc39 T A 3: 33,886,808 (GRCm39) K267* probably null Het
Ccdc47 C A 11: 106,092,971 (GRCm39) V92L possibly damaging Het
Cyp2c54 A T 19: 40,059,990 (GRCm39) I181N probably damaging Het
Ddx60 A T 8: 62,427,184 (GRCm39) D753V probably damaging Het
Dlg2 A T 7: 91,935,796 (GRCm39) K641N probably damaging Het
Eloa G A 4: 135,736,668 (GRCm39) R527C probably benign Het
Fancd2 C T 6: 113,545,187 (GRCm39) P835L probably damaging Het
Fbln2 C G 6: 91,227,846 (GRCm39) T428S probably damaging Het
Fbn2 G A 18: 58,153,462 (GRCm39) A2600V possibly damaging Het
Gbe1 A G 16: 70,233,876 (GRCm39) Y251C probably damaging Het
Gnptab T A 10: 88,268,508 (GRCm39) probably null Het
Hspa1a T A 17: 35,191,033 (GRCm39) probably benign Het
Ifi204 G A 1: 173,587,839 (GRCm39) P107S probably damaging Het
Kif6 A G 17: 49,978,164 (GRCm39) I119V probably damaging Het
Lmntd2 G A 7: 140,790,427 (GRCm39) H554Y probably benign Het
Lrrc8e C A 8: 4,284,218 (GRCm39) H148N probably damaging Het
Lrriq1 T C 10: 103,050,914 (GRCm39) N613D probably damaging Het
Map4k4 C T 1: 40,028,136 (GRCm39) T319M probably damaging Het
Mbtps1 C T 8: 120,268,413 (GRCm39) V253I probably damaging Het
Mcm4 C A 16: 15,450,042 (GRCm39) C330F probably damaging Het
Mok A G 12: 110,776,341 (GRCm39) probably null Het
Nedd4 T C 9: 72,577,321 (GRCm39) C49R probably damaging Het
Nlrp4e T C 7: 23,020,983 (GRCm39) V490A probably benign Het
Nsf A T 11: 103,819,584 (GRCm39) F27I probably damaging Het
Or10g3b A T 14: 52,586,696 (GRCm39) L269Q probably damaging Het
Or14c44 A G 7: 86,061,647 (GRCm39) S26G probably benign Het
Or4a47 T C 2: 89,665,609 (GRCm39) N227D probably benign Het
Or5p73 G T 7: 108,064,784 (GRCm39) M84I possibly damaging Het
Or6c66 A G 10: 129,461,114 (GRCm39) I272T possibly damaging Het
Pax1 A G 2: 147,206,968 (GRCm39) M1V probably null Het
Pcdhga12 A G 18: 37,900,631 (GRCm39) T488A probably damaging Het
Plekhh2 A G 17: 84,864,909 (GRCm39) D99G possibly damaging Het
Polr3h T C 15: 81,800,824 (GRCm39) T173A probably benign Het
Pramel6 C T 2: 87,339,045 (GRCm39) L82F probably damaging Het
Ralgapa2 A T 2: 146,230,463 (GRCm39) I1034N probably damaging Het
Rbfox1 G A 16: 7,042,319 (GRCm39) V58I probably damaging Het
Reln T A 5: 22,104,027 (GRCm39) I3315L probably benign Het
Rev3l T A 10: 39,682,844 (GRCm39) S321T probably damaging Het
Ryr1 T C 7: 28,740,292 (GRCm39) T3908A probably damaging Het
Secisbp2l G T 2: 125,617,502 (GRCm39) Y58* probably null Het
Sgms1 C A 19: 32,102,697 (GRCm39) V337L probably benign Het
Slc38a2 G A 15: 96,593,172 (GRCm39) Q136* probably null Het
Smarcd1 T A 15: 99,605,657 (GRCm39) V296D probably damaging Het
Smcr8 A C 11: 60,674,822 (GRCm39) H866P probably damaging Het
Spcs1 T A 14: 30,722,721 (GRCm39) I33L probably benign Het
Stxbp5 T C 10: 9,688,033 (GRCm39) R423G possibly damaging Het
Syt4 A T 18: 31,576,790 (GRCm39) M188K possibly damaging Het
Tchhl1 A G 3: 93,376,869 (GRCm39) D22G probably damaging Het
Tiparp T A 3: 65,453,655 (GRCm39) N134K probably benign Het
Topaz1 A G 9: 122,579,001 (GRCm39) D637G possibly damaging Het
Trav14d-3-dv8 A T 14: 53,316,192 (GRCm39) probably benign Het
Vmn1r77 T A 7: 11,775,514 (GRCm39) S29T probably damaging Het
Vps13d A G 4: 144,881,817 (GRCm39) F1253L probably benign Het
Zfp407 G A 18: 84,580,895 (GRCm39) R73* probably null Het
Zfp446 T A 7: 12,716,555 (GRCm39) F334I possibly damaging Het
Zfp654 A T 16: 64,606,011 (GRCm39) Y730* probably null Het
Other mutations in Vmn1r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn1r19 APN 6 57,382,247 (GRCm39) missense probably benign 0.03
IGL01287:Vmn1r19 APN 6 57,382,179 (GRCm39) missense probably damaging 1.00
IGL01516:Vmn1r19 APN 6 57,381,857 (GRCm39) missense probably benign 0.03
IGL01895:Vmn1r19 APN 6 57,382,245 (GRCm39) missense probably benign 0.02
IGL02676:Vmn1r19 APN 6 57,382,025 (GRCm39) missense possibly damaging 0.94
IGL03040:Vmn1r19 APN 6 57,382,347 (GRCm39) missense unknown
IGL03087:Vmn1r19 APN 6 57,381,476 (GRCm39) missense probably benign 0.01
PIT4802001:Vmn1r19 UTSW 6 57,382,037 (GRCm39) missense probably damaging 1.00
R0319:Vmn1r19 UTSW 6 57,381,600 (GRCm39) missense possibly damaging 0.93
R1368:Vmn1r19 UTSW 6 57,381,656 (GRCm39) missense probably benign 0.01
R1997:Vmn1r19 UTSW 6 57,382,033 (GRCm39) missense probably damaging 1.00
R2920:Vmn1r19 UTSW 6 57,381,909 (GRCm39) missense probably benign 0.03
R3857:Vmn1r19 UTSW 6 57,382,098 (GRCm39) missense possibly damaging 0.68
R4090:Vmn1r19 UTSW 6 57,381,720 (GRCm39) missense probably damaging 1.00
R4547:Vmn1r19 UTSW 6 57,381,774 (GRCm39) missense possibly damaging 0.56
R4823:Vmn1r19 UTSW 6 57,382,219 (GRCm39) nonsense probably null
R4951:Vmn1r19 UTSW 6 57,381,927 (GRCm39) missense probably benign 0.36
R5077:Vmn1r19 UTSW 6 57,382,026 (GRCm39) missense probably benign 0.00
R5459:Vmn1r19 UTSW 6 57,381,475 (GRCm39) nonsense probably null
R5625:Vmn1r19 UTSW 6 57,382,281 (GRCm39) missense probably damaging 1.00
R5690:Vmn1r19 UTSW 6 57,381,780 (GRCm39) missense probably benign 0.10
R5761:Vmn1r19 UTSW 6 57,382,338 (GRCm39) missense unknown
R6124:Vmn1r19 UTSW 6 57,381,602 (GRCm39) missense probably benign 0.02
R6373:Vmn1r19 UTSW 6 57,382,317 (GRCm39) missense unknown
R6476:Vmn1r19 UTSW 6 57,381,578 (GRCm39) missense probably damaging 0.99
R6938:Vmn1r19 UTSW 6 57,381,992 (GRCm39) missense possibly damaging 0.94
R7027:Vmn1r19 UTSW 6 57,381,475 (GRCm39) nonsense probably null
R7359:Vmn1r19 UTSW 6 57,382,080 (GRCm39) missense probably damaging 0.99
R7568:Vmn1r19 UTSW 6 57,381,813 (GRCm39) missense possibly damaging 0.69
R7893:Vmn1r19 UTSW 6 57,381,664 (GRCm39) missense probably damaging 1.00
R8481:Vmn1r19 UTSW 6 57,381,932 (GRCm39) missense probably damaging 0.99
R8812:Vmn1r19 UTSW 6 57,381,436 (GRCm39) start gained probably benign
R8907:Vmn1r19 UTSW 6 57,381,991 (GRCm39) missense probably benign
R8976:Vmn1r19 UTSW 6 57,381,719 (GRCm39) missense probably benign 0.01
R9277:Vmn1r19 UTSW 6 57,382,322 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCATGAACTACATCATCAGGGG -3'
(R):5'- AGAAAATCTACTGGCACTTGGAG -3'

Sequencing Primer
(F):5'- CAGTGACAATGTCCAGAGATATATG -3'
(R):5'- TGATCTGCACCAAAGGAG -3'
Posted On 2021-01-18