Incidental Mutation 'R8487:Nlrp4e'
ID657788
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8487 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23321558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 490 (V490A)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: V490A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: V490A

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,859,486 I153V probably benign Het
Arhgap21 A C 2: 20,881,305 S354A probably benign Het
Bcan T C 3: 87,989,209 T727A probably damaging Het
Brinp1 C T 4: 68,829,455 G137E probably damaging Het
Catsperd A G 17: 56,663,419 Y697C probably damaging Het
Ccdc39 T A 3: 33,832,659 K267* probably null Het
Ccdc47 C A 11: 106,202,145 V92L possibly damaging Het
Cyp2c54 A T 19: 40,071,546 I181N probably damaging Het
Ddx60 A T 8: 61,974,150 D753V probably damaging Het
Dlg2 A T 7: 92,286,588 K641N probably damaging Het
Eloa G A 4: 136,009,357 R527C probably benign Het
Fancd2 C T 6: 113,568,226 P835L probably damaging Het
Fbln2 C G 6: 91,250,864 T428S probably damaging Het
Fbn2 G A 18: 58,020,390 A2600V possibly damaging Het
Gbe1 A G 16: 70,436,988 Y251C probably damaging Het
Gnptab T A 10: 88,432,646 probably null Het
Hspa1a T A 17: 34,972,057 probably benign Het
Ifi204 G A 1: 173,760,273 P107S probably damaging Het
Kif6 A G 17: 49,671,136 I119V probably damaging Het
Lmntd2 G A 7: 141,210,514 H554Y probably benign Het
Lrrc8e C A 8: 4,234,218 H148N probably damaging Het
Lrriq1 T C 10: 103,215,053 N613D probably damaging Het
Map4k4 C T 1: 39,988,976 T319M probably damaging Het
Mbtps1 C T 8: 119,541,674 V253I probably damaging Het
Mcm4 C A 16: 15,632,178 C330F probably damaging Het
Mok A G 12: 110,809,907 probably null Het
Nedd4 T C 9: 72,670,039 C49R probably damaging Het
Nsf A T 11: 103,928,758 F27I probably damaging Het
Olfr1256 T C 2: 89,835,265 N227D probably benign Het
Olfr1513 A T 14: 52,349,239 L269Q probably damaging Het
Olfr301 A G 7: 86,412,439 S26G probably benign Het
Olfr498 G T 7: 108,465,577 M84I possibly damaging Het
Olfr798 A G 10: 129,625,245 I272T possibly damaging Het
Pax1 A G 2: 147,365,048 M1V probably null Het
Pcdhga12 A G 18: 37,767,578 T488A probably damaging Het
Plekhh2 A G 17: 84,557,481 D99G possibly damaging Het
Polr3h T C 15: 81,916,623 T173A probably benign Het
Pramel6 C T 2: 87,508,701 L82F probably damaging Het
Ralgapa2 A T 2: 146,388,543 I1034N probably damaging Het
Rbfox1 G A 16: 7,224,455 V58I probably damaging Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rev3l T A 10: 39,806,848 S321T probably damaging Het
Ryr1 T C 7: 29,040,867 T3908A probably damaging Het
Secisbp2l G T 2: 125,775,582 Y58* probably null Het
Sgms1 C A 19: 32,125,297 V337L probably benign Het
Slc38a2 G A 15: 96,695,291 Q136* probably null Het
Smarcd1 T A 15: 99,707,776 V296D probably damaging Het
Smcr8 A C 11: 60,783,996 H866P probably damaging Het
Spcs1 T A 14: 31,000,764 I33L probably benign Het
Stxbp5 T C 10: 9,812,289 R423G possibly damaging Het
Syt4 A T 18: 31,443,737 M188K possibly damaging Het
Tchhl1 A G 3: 93,469,562 D22G probably damaging Het
Tiparp T A 3: 65,546,234 N134K probably benign Het
Topaz1 A G 9: 122,749,936 D637G possibly damaging Het
Trav14d-3-dv8 A T 14: 53,078,735 probably benign Het
Vmn1r19 A T 6: 57,405,181 M240L probably benign Het
Vmn1r77 T A 7: 12,041,587 S29T probably damaging Het
Vps13d A G 4: 145,155,247 F1253L probably benign Het
Zfp407 G A 18: 84,562,770 R73* probably null Het
Zfp446 T A 7: 12,982,628 F334I possibly damaging Het
Zfp654 A T 16: 64,785,648 Y730* probably null Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCTGGACGTAAGGATCCTTG -3'
(R):5'- AAGAAGGCTTCATCGTCCATCTC -3'

Sequencing Primer
(F):5'- CTGGACGTAAGGATCCTTGAAAAG -3'
(R):5'- GGCTTCATCGTCCATCTCAAACAG -3'
Posted On2021-01-18