Mutagenetix > Incidental Mutation

Incidental Mutation 'R8487:Lrrc8e'

657794

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8e

Ensembl Gene

ENSMUSG00000046589

Gene Name

leucine rich repeat containing 8 family, member E

Synonyms

1810049O03Rik, C87354

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R8487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4226827-4237470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4234218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 148 (H148N)

Ref Sequence

ENSEMBL: ENSMUSP00000052055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]

AlphaFold

Q66JT1

Predicted Effect

probably benign
Transcript: ENSMUST00000003027

SMART Domains

Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
S_TKc	136	396	8.43e-72	SMART
low complexity region	435	455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000053035
AA Change: H148N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: H148N

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	330	3.8e-143	PFAM
low complexity region	504	516	N/A	INTRINSIC
LRR	603	627	3.97e0	SMART
LRR	628	650	2.33e2	SMART
LRR_TYP	651	674	6.08e-5	SMART
LRR	676	696	6.78e1	SMART
LRR_TYP	697	720	2.43e-4	SMART
LRR	721	742	1.09e2	SMART
LRR_TYP	743	766	9.44e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062686

SMART Domains

Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
S_TKc	136	396	8.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110998

SMART Domains

Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	53	73	N/A	INTRINSIC
S_TKc	120	380	8.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110999

SMART Domains

Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	53	73	N/A	INTRINSIC
S_TKc	120	380	8.43e-72	SMART
low complexity region	419	439	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145165

SMART Domains

Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	69	89	N/A	INTRINSIC
S_TKc	136	396	8.43e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207770

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,859,486	I153V	probably benign	Het
Arhgap21	A	C	2: 20,881,305	S354A	probably benign	Het
Bcan	T	C	3: 87,989,209	T727A	probably damaging	Het
Brinp1	C	T	4: 68,829,455	G137E	probably damaging	Het
Catsperd	A	G	17: 56,663,419	Y697C	probably damaging	Het
Ccdc39	T	A	3: 33,832,659	K267*	probably null	Het
Ccdc47	C	A	11: 106,202,145	V92L	possibly damaging	Het
Cyp2c54	A	T	19: 40,071,546	I181N	probably damaging	Het
Ddx60	A	T	8: 61,974,150	D753V	probably damaging	Het
Dlg2	A	T	7: 92,286,588	K641N	probably damaging	Het
Eloa	G	A	4: 136,009,357	R527C	probably benign	Het
Fancd2	C	T	6: 113,568,226	P835L	probably damaging	Het
Fbln2	C	G	6: 91,250,864	T428S	probably damaging	Het
Fbn2	G	A	18: 58,020,390	A2600V	possibly damaging	Het
Gbe1	A	G	16: 70,436,988	Y251C	probably damaging	Het
Gnptab	T	A	10: 88,432,646		probably null	Het
Hspa1a	T	A	17: 34,972,057		probably benign	Het
Ifi204	G	A	1: 173,760,273	P107S	probably damaging	Het
Kif6	A	G	17: 49,671,136	I119V	probably damaging	Het
Lmntd2	G	A	7: 141,210,514	H554Y	probably benign	Het
Lrriq1	T	C	10: 103,215,053	N613D	probably damaging	Het
Map4k4	C	T	1: 39,988,976	T319M	probably damaging	Het
Mbtps1	C	T	8: 119,541,674	V253I	probably damaging	Het
Mcm4	C	A	16: 15,632,178	C330F	probably damaging	Het
Mok	A	G	12: 110,809,907		probably null	Het
Nedd4	T	C	9: 72,670,039	C49R	probably damaging	Het
Nlrp4e	T	C	7: 23,321,558	V490A	probably benign	Het
Nsf	A	T	11: 103,928,758	F27I	probably damaging	Het
Olfr1256	T	C	2: 89,835,265	N227D	probably benign	Het
Olfr1513	A	T	14: 52,349,239	L269Q	probably damaging	Het
Olfr301	A	G	7: 86,412,439	S26G	probably benign	Het
Olfr498	G	T	7: 108,465,577	M84I	possibly damaging	Het
Olfr798	A	G	10: 129,625,245	I272T	possibly damaging	Het
Pax1	A	G	2: 147,365,048	M1V	probably null	Het
Pcdhga12	A	G	18: 37,767,578	T488A	probably damaging	Het
Plekhh2	A	G	17: 84,557,481	D99G	possibly damaging	Het
Polr3h	T	C	15: 81,916,623	T173A	probably benign	Het
Pramel6	C	T	2: 87,508,701	L82F	probably damaging	Het
Ralgapa2	A	T	2: 146,388,543	I1034N	probably damaging	Het
Rbfox1	G	A	16: 7,224,455	V58I	probably damaging	Het
Reln	T	A	5: 21,899,029	I3315L	probably benign	Het
Rev3l	T	A	10: 39,806,848	S321T	probably damaging	Het
Ryr1	T	C	7: 29,040,867	T3908A	probably damaging	Het
Secisbp2l	G	T	2: 125,775,582	Y58*	probably null	Het
Sgms1	C	A	19: 32,125,297	V337L	probably benign	Het
Slc38a2	G	A	15: 96,695,291	Q136*	probably null	Het
Smarcd1	T	A	15: 99,707,776	V296D	probably damaging	Het
Smcr8	A	C	11: 60,783,996	H866P	probably damaging	Het
Spcs1	T	A	14: 31,000,764	I33L	probably benign	Het
Stxbp5	T	C	10: 9,812,289	R423G	possibly damaging	Het
Syt4	A	T	18: 31,443,737	M188K	possibly damaging	Het
Tchhl1	A	G	3: 93,469,562	D22G	probably damaging	Het
Tiparp	T	A	3: 65,546,234	N134K	probably benign	Het
Topaz1	A	G	9: 122,749,936	D637G	possibly damaging	Het
Trav14d-3-dv8	A	T	14: 53,078,735		probably benign	Het
Vmn1r19	A	T	6: 57,405,181	M240L	probably benign	Het
Vmn1r77	T	A	7: 12,041,587	S29T	probably damaging	Het
Vps13d	A	G	4: 145,155,247	F1253L	probably benign	Het
Zfp407	G	A	18: 84,562,770	R73*	probably null	Het
Zfp446	T	A	7: 12,982,628	F334I	possibly damaging	Het
Zfp654	A	T	16: 64,785,648	Y730*	probably null	Het

Other mutations in Lrrc8e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Lrrc8e	APN	8	4235921	missense	probably benign
IGL00943:Lrrc8e	APN	8	4235658	missense	probably damaging	1.00
IGL00979:Lrrc8e	APN	8	4235080	missense	probably damaging	1.00
IGL01138:Lrrc8e	APN	8	4234084	missense	probably damaging	1.00
IGL01458:Lrrc8e	APN	8	4236141	missense	probably damaging	1.00
IGL02524:Lrrc8e	APN	8	4235392	missense	probably damaging	1.00
IGL02831:Lrrc8e	APN	8	4235429	missense	probably damaging	0.96
IGL03135:Lrrc8e	APN	8	4235776	missense	probably damaging	1.00
R0242:Lrrc8e	UTSW	8	4235401	missense	probably benign	0.00
R0242:Lrrc8e	UTSW	8	4235401	missense	probably benign	0.00
R0312:Lrrc8e	UTSW	8	4235733	missense	probably benign
R0601:Lrrc8e	UTSW	8	4235239	splice site	probably null
R1167:Lrrc8e	UTSW	8	4235337	missense	probably benign
R1405:Lrrc8e	UTSW	8	4231754	missense	probably damaging	1.00
R1405:Lrrc8e	UTSW	8	4231754	missense	probably damaging	1.00
R1540:Lrrc8e	UTSW	8	4234990	missense	probably benign	0.41
R1677:Lrrc8e	UTSW	8	4234190	missense	probably damaging	1.00
R1916:Lrrc8e	UTSW	8	4235202	missense	probably benign	0.01
R2185:Lrrc8e	UTSW	8	4234986	nonsense	probably null
R2290:Lrrc8e	UTSW	8	4231770	missense	probably damaging	1.00
R3424:Lrrc8e	UTSW	8	4234611	missense	probably damaging	1.00
R4628:Lrrc8e	UTSW	8	4233981	missense	probably damaging	1.00
R4996:Lrrc8e	UTSW	8	4235166	missense	probably damaging	1.00
R5169:Lrrc8e	UTSW	8	4234329	missense	probably benign
R5516:Lrrc8e	UTSW	8	4235818	missense	probably damaging	1.00
R5870:Lrrc8e	UTSW	8	4235725	missense	possibly damaging	0.60
R6687:Lrrc8e	UTSW	8	4234798	missense	probably damaging	1.00
R6700:Lrrc8e	UTSW	8	4236034	missense	probably damaging	1.00
R7344:Lrrc8e	UTSW	8	4234815	missense	probably damaging	1.00
R7350:Lrrc8e	UTSW	8	4235626	missense	probably benign	0.14
R7555:Lrrc8e	UTSW	8	4234363	missense	probably benign	0.05
R7691:Lrrc8e	UTSW	8	4234534	missense	probably damaging	1.00
R8112:Lrrc8e	UTSW	8	4235575	missense	probably benign	0.14
R8184:Lrrc8e	UTSW	8	4235140	missense	probably damaging	0.99
R8328:Lrrc8e	UTSW	8	4235641	missense	probably damaging	1.00
R8355:Lrrc8e	UTSW	8	4234018	missense	probably benign	0.02
R8810:Lrrc8e	UTSW	8	4235070	missense	probably benign	0.03
R8971:Lrrc8e	UTSW	8	4234141	missense	probably damaging	1.00
R9088:Lrrc8e	UTSW	8	4234410	missense	probably damaging	0.96
R9150:Lrrc8e	UTSW	8	4236030	missense	probably benign	0.06
R9225:Lrrc8e	UTSW	8	4234561	missense	probably damaging	1.00
R9255:Lrrc8e	UTSW	8	4234504	missense	probably damaging	1.00
R9442:Lrrc8e	UTSW	8	4233964	missense	probably benign	0.01
R9463:Lrrc8e	UTSW	8	4235185	missense	probably damaging	0.99
R9475:Lrrc8e	UTSW	8	4235346	missense	probably benign
Z1176:Lrrc8e	UTSW	8	4234822	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GAATCTCTGAGCAGATGGGG -3'
(R):5'- ACCTTTTCGGGCTCAATGAG -3'

Sequencing Primer
(F):5'- GAGAGCTCAGTGGCCTCAAAAAC -3'
(R):5'- AATGAGCACTTTCTCCTTCTCAC -3'

Posted On

2021-01-18