Incidental Mutation 'R8487:Nsf'
ID 657805
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene Name N-ethylmaleimide sensitive fusion protein
Synonyms SKD2, N-ethylmaleimide sensitive factor
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103821782-103954056 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103928758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 27 (F27I)
Ref Sequence ENSEMBL: ENSMUSP00000133591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
AlphaFold P46460
Predicted Effect probably damaging
Transcript: ENSMUST00000103075
AA Change: F62I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: F62I

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133774
AA Change: F27I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187
AA Change: F27I

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149642
AA Change: F59I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: F59I

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,859,486 I153V probably benign Het
Arhgap21 A C 2: 20,881,305 S354A probably benign Het
Bcan T C 3: 87,989,209 T727A probably damaging Het
Brinp1 C T 4: 68,829,455 G137E probably damaging Het
Catsperd A G 17: 56,663,419 Y697C probably damaging Het
Ccdc39 T A 3: 33,832,659 K267* probably null Het
Ccdc47 C A 11: 106,202,145 V92L possibly damaging Het
Cyp2c54 A T 19: 40,071,546 I181N probably damaging Het
Ddx60 A T 8: 61,974,150 D753V probably damaging Het
Dlg2 A T 7: 92,286,588 K641N probably damaging Het
Eloa G A 4: 136,009,357 R527C probably benign Het
Fancd2 C T 6: 113,568,226 P835L probably damaging Het
Fbln2 C G 6: 91,250,864 T428S probably damaging Het
Fbn2 G A 18: 58,020,390 A2600V possibly damaging Het
Gbe1 A G 16: 70,436,988 Y251C probably damaging Het
Gnptab T A 10: 88,432,646 probably null Het
Hspa1a T A 17: 34,972,057 probably benign Het
Ifi204 G A 1: 173,760,273 P107S probably damaging Het
Kif6 A G 17: 49,671,136 I119V probably damaging Het
Lmntd2 G A 7: 141,210,514 H554Y probably benign Het
Lrrc8e C A 8: 4,234,218 H148N probably damaging Het
Lrriq1 T C 10: 103,215,053 N613D probably damaging Het
Map4k4 C T 1: 39,988,976 T319M probably damaging Het
Mbtps1 C T 8: 119,541,674 V253I probably damaging Het
Mcm4 C A 16: 15,632,178 C330F probably damaging Het
Mok A G 12: 110,809,907 probably null Het
Nedd4 T C 9: 72,670,039 C49R probably damaging Het
Nlrp4e T C 7: 23,321,558 V490A probably benign Het
Olfr1256 T C 2: 89,835,265 N227D probably benign Het
Olfr1513 A T 14: 52,349,239 L269Q probably damaging Het
Olfr301 A G 7: 86,412,439 S26G probably benign Het
Olfr498 G T 7: 108,465,577 M84I possibly damaging Het
Olfr798 A G 10: 129,625,245 I272T possibly damaging Het
Pax1 A G 2: 147,365,048 M1V probably null Het
Pcdhga12 A G 18: 37,767,578 T488A probably damaging Het
Plekhh2 A G 17: 84,557,481 D99G possibly damaging Het
Polr3h T C 15: 81,916,623 T173A probably benign Het
Pramel6 C T 2: 87,508,701 L82F probably damaging Het
Ralgapa2 A T 2: 146,388,543 I1034N probably damaging Het
Rbfox1 G A 16: 7,224,455 V58I probably damaging Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rev3l T A 10: 39,806,848 S321T probably damaging Het
Ryr1 T C 7: 29,040,867 T3908A probably damaging Het
Secisbp2l G T 2: 125,775,582 Y58* probably null Het
Sgms1 C A 19: 32,125,297 V337L probably benign Het
Slc38a2 G A 15: 96,695,291 Q136* probably null Het
Smarcd1 T A 15: 99,707,776 V296D probably damaging Het
Smcr8 A C 11: 60,783,996 H866P probably damaging Het
Spcs1 T A 14: 31,000,764 I33L probably benign Het
Stxbp5 T C 10: 9,812,289 R423G possibly damaging Het
Syt4 A T 18: 31,443,737 M188K possibly damaging Het
Tchhl1 A G 3: 93,469,562 D22G probably damaging Het
Tiparp T A 3: 65,546,234 N134K probably benign Het
Topaz1 A G 9: 122,749,936 D637G possibly damaging Het
Trav14d-3-dv8 A T 14: 53,078,735 probably benign Het
Vmn1r19 A T 6: 57,405,181 M240L probably benign Het
Vmn1r77 T A 7: 12,041,587 S29T probably damaging Het
Vps13d A G 4: 145,155,247 F1253L probably benign Het
Zfp407 G A 18: 84,562,770 R73* probably null Het
Zfp446 T A 7: 12,982,628 F334I possibly damaging Het
Zfp654 A T 16: 64,785,648 Y730* probably null Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
R7769:Nsf UTSW 11 103928839 missense probably damaging 1.00
R8323:Nsf UTSW 11 103928839 missense probably benign 0.05
R8856:Nsf UTSW 11 103930742 missense possibly damaging 0.69
R9253:Nsf UTSW 11 103913316 missense probably null 1.00
R9476:Nsf UTSW 11 103873162 missense probably damaging 1.00
R9509:Nsf UTSW 11 103863248 missense probably benign 0.19
R9510:Nsf UTSW 11 103873162 missense probably damaging 1.00
R9520:Nsf UTSW 11 103913883 missense probably damaging 1.00
R9546:Nsf UTSW 11 103910449 nonsense probably null
R9632:Nsf UTSW 11 103823768 missense probably damaging 1.00
R9779:Nsf UTSW 11 103828526 missense probably damaging 0.99
X0066:Nsf UTSW 11 103823740 missense probably benign
Z1176:Nsf UTSW 11 103910554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGCCCTCCCTGTAAACAAAG -3'
(R):5'- CAGGGCTCTCCTATGTGTTG -3'

Sequencing Primer
(F):5'- CTAGGTGGTTCTCTTTGCTA -3'
(R):5'- CCTATGTGTTGTCTGTGTCTCCTATG -3'
Posted On 2021-01-18