Mutagenetix > Incidental Mutation

Incidental Mutation 'R8487:Mcm4'

657815

Institutional Source

Beutler Lab

Gene Symbol

Mcm4

Ensembl Gene

ENSMUSG00000022673

Gene Name

minichromosome maintenance complex component 4

Synonyms

mCdc21, Mcmd4, 19G, Cdc21

MMRRC Submission

067930-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15441761-15455264 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 15450042 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 330 (C330F)

Ref Sequence

ENSEMBL: ENSMUSP00000023353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023353]

AlphaFold

P49717

Predicted Effect

probably damaging
Transcript: ENSMUST00000023353
AA Change: C330F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: C330F

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	23	40	N/A	INTRINSIC
MCM	266	769	N/A	SMART
AAA	501	653	7.04e-3	SMART
Blast:MCM	781	849	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000229606

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,565,122 (GRCm39)	I153V	probably benign	Het
Arhgap21	A	C	2: 20,886,116 (GRCm39)	S354A	probably benign	Het
Bcan	T	C	3: 87,896,516 (GRCm39)	T727A	probably damaging	Het
Brinp1	C	T	4: 68,747,692 (GRCm39)	G137E	probably damaging	Het
Catsperd	A	G	17: 56,970,419 (GRCm39)	Y697C	probably damaging	Het
Ccdc39	T	A	3: 33,886,808 (GRCm39)	K267*	probably null	Het
Ccdc47	C	A	11: 106,092,971 (GRCm39)	V92L	possibly damaging	Het
Cyp2c54	A	T	19: 40,059,990 (GRCm39)	I181N	probably damaging	Het
Ddx60	A	T	8: 62,427,184 (GRCm39)	D753V	probably damaging	Het
Dlg2	A	T	7: 91,935,796 (GRCm39)	K641N	probably damaging	Het
Eloa	G	A	4: 135,736,668 (GRCm39)	R527C	probably benign	Het
Fancd2	C	T	6: 113,545,187 (GRCm39)	P835L	probably damaging	Het
Fbln2	C	G	6: 91,227,846 (GRCm39)	T428S	probably damaging	Het
Fbn2	G	A	18: 58,153,462 (GRCm39)	A2600V	possibly damaging	Het
Gbe1	A	G	16: 70,233,876 (GRCm39)	Y251C	probably damaging	Het
Gnptab	T	A	10: 88,268,508 (GRCm39)		probably null	Het
Hspa1a	T	A	17: 35,191,033 (GRCm39)		probably benign	Het
Ifi204	G	A	1: 173,587,839 (GRCm39)	P107S	probably damaging	Het
Kif6	A	G	17: 49,978,164 (GRCm39)	I119V	probably damaging	Het
Lmntd2	G	A	7: 140,790,427 (GRCm39)	H554Y	probably benign	Het
Lrrc8e	C	A	8: 4,284,218 (GRCm39)	H148N	probably damaging	Het
Lrriq1	T	C	10: 103,050,914 (GRCm39)	N613D	probably damaging	Het
Map4k4	C	T	1: 40,028,136 (GRCm39)	T319M	probably damaging	Het
Mbtps1	C	T	8: 120,268,413 (GRCm39)	V253I	probably damaging	Het
Mok	A	G	12: 110,776,341 (GRCm39)		probably null	Het
Nedd4	T	C	9: 72,577,321 (GRCm39)	C49R	probably damaging	Het
Nlrp4e	T	C	7: 23,020,983 (GRCm39)	V490A	probably benign	Het
Nsf	A	T	11: 103,819,584 (GRCm39)	F27I	probably damaging	Het
Or10g3b	A	T	14: 52,586,696 (GRCm39)	L269Q	probably damaging	Het
Or14c44	A	G	7: 86,061,647 (GRCm39)	S26G	probably benign	Het
Or4a47	T	C	2: 89,665,609 (GRCm39)	N227D	probably benign	Het
Or5p73	G	T	7: 108,064,784 (GRCm39)	M84I	possibly damaging	Het
Or6c66	A	G	10: 129,461,114 (GRCm39)	I272T	possibly damaging	Het
Pax1	A	G	2: 147,206,968 (GRCm39)	M1V	probably null	Het
Pcdhga12	A	G	18: 37,900,631 (GRCm39)	T488A	probably damaging	Het
Plekhh2	A	G	17: 84,864,909 (GRCm39)	D99G	possibly damaging	Het
Polr3h	T	C	15: 81,800,824 (GRCm39)	T173A	probably benign	Het
Pramel6	C	T	2: 87,339,045 (GRCm39)	L82F	probably damaging	Het
Ralgapa2	A	T	2: 146,230,463 (GRCm39)	I1034N	probably damaging	Het
Rbfox1	G	A	16: 7,042,319 (GRCm39)	V58I	probably damaging	Het
Reln	T	A	5: 22,104,027 (GRCm39)	I3315L	probably benign	Het
Rev3l	T	A	10: 39,682,844 (GRCm39)	S321T	probably damaging	Het
Ryr1	T	C	7: 28,740,292 (GRCm39)	T3908A	probably damaging	Het
Secisbp2l	G	T	2: 125,617,502 (GRCm39)	Y58*	probably null	Het
Sgms1	C	A	19: 32,102,697 (GRCm39)	V337L	probably benign	Het
Slc38a2	G	A	15: 96,593,172 (GRCm39)	Q136*	probably null	Het
Smarcd1	T	A	15: 99,605,657 (GRCm39)	V296D	probably damaging	Het
Smcr8	A	C	11: 60,674,822 (GRCm39)	H866P	probably damaging	Het
Spcs1	T	A	14: 30,722,721 (GRCm39)	I33L	probably benign	Het
Stxbp5	T	C	10: 9,688,033 (GRCm39)	R423G	possibly damaging	Het
Syt4	A	T	18: 31,576,790 (GRCm39)	M188K	possibly damaging	Het
Tchhl1	A	G	3: 93,376,869 (GRCm39)	D22G	probably damaging	Het
Tiparp	T	A	3: 65,453,655 (GRCm39)	N134K	probably benign	Het
Topaz1	A	G	9: 122,579,001 (GRCm39)	D637G	possibly damaging	Het
Trav14d-3-dv8	A	T	14: 53,316,192 (GRCm39)		probably benign	Het
Vmn1r19	A	T	6: 57,382,166 (GRCm39)	M240L	probably benign	Het
Vmn1r77	T	A	7: 11,775,514 (GRCm39)	S29T	probably damaging	Het
Vps13d	A	G	4: 144,881,817 (GRCm39)	F1253L	probably benign	Het
Zfp407	G	A	18: 84,580,895 (GRCm39)	R73*	probably null	Het
Zfp446	T	A	7: 12,716,555 (GRCm39)	F334I	possibly damaging	Het
Zfp654	A	T	16: 64,606,011 (GRCm39)	Y730*	probably null	Het

Other mutations in Mcm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Mcm4	APN	16	15,443,995 (GRCm39)	missense	probably damaging	1.00
IGL01982:Mcm4	APN	16	15,448,284 (GRCm39)	missense	possibly damaging	0.57
IGL02382:Mcm4	APN	16	15,442,602 (GRCm39)	missense	probably damaging	1.00
PIT4687001:Mcm4	UTSW	16	15,454,577 (GRCm39)	missense	probably benign	0.01
R0200:Mcm4	UTSW	16	15,447,503 (GRCm39)	missense	probably benign	0.41
R0540:Mcm4	UTSW	16	15,449,979 (GRCm39)	critical splice donor site	probably null
R0607:Mcm4	UTSW	16	15,449,979 (GRCm39)	critical splice donor site	probably null
R2064:Mcm4	UTSW	16	15,452,333 (GRCm39)	missense	possibly damaging	0.75
R4240:Mcm4	UTSW	16	15,445,570 (GRCm39)	nonsense	probably null
R4604:Mcm4	UTSW	16	15,447,527 (GRCm39)	missense	probably damaging	1.00
R4871:Mcm4	UTSW	16	15,452,374 (GRCm39)	nonsense	probably null
R5070:Mcm4	UTSW	16	15,443,434 (GRCm39)	missense	probably damaging	1.00
R5125:Mcm4	UTSW	16	15,453,167 (GRCm39)	missense	probably benign	0.21
R5178:Mcm4	UTSW	16	15,453,167 (GRCm39)	missense	probably benign	0.21
R5245:Mcm4	UTSW	16	15,448,289 (GRCm39)	missense	probably benign	0.02
R5513:Mcm4	UTSW	16	15,448,378 (GRCm39)	missense	probably benign	0.26
R5696:Mcm4	UTSW	16	15,443,434 (GRCm39)	missense	probably damaging	1.00
R6453:Mcm4	UTSW	16	15,448,273 (GRCm39)	missense	probably damaging	1.00
R6753:Mcm4	UTSW	16	15,447,226 (GRCm39)	missense	possibly damaging	0.91
R6909:Mcm4	UTSW	16	15,446,561 (GRCm39)	missense	probably damaging	1.00
R6937:Mcm4	UTSW	16	15,454,199 (GRCm39)	missense	probably benign
R7402:Mcm4	UTSW	16	15,455,042 (GRCm39)	start codon destroyed	probably null
R7483:Mcm4	UTSW	16	15,448,306 (GRCm39)	missense	probably benign	0.05
R8275:Mcm4	UTSW	16	15,452,435 (GRCm39)	missense	probably damaging	0.98
R8683:Mcm4	UTSW	16	15,453,138 (GRCm39)	missense	probably damaging	0.99
R8742:Mcm4	UTSW	16	15,443,430 (GRCm39)	missense	possibly damaging	0.52
R8929:Mcm4	UTSW	16	15,448,289 (GRCm39)	missense	probably benign	0.02
R9138:Mcm4	UTSW	16	15,447,200 (GRCm39)	missense	probably damaging	1.00
R9440:Mcm4	UTSW	16	15,453,175 (GRCm39)	nonsense	probably null
Z1177:Mcm4	UTSW	16	15,450,080 (GRCm39)	missense	possibly damaging	0.55
Z1177:Mcm4	UTSW	16	15,447,318 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTCAGTGTGCTCTAAGC -3'
(R):5'- CTGGTAGACAAGCCAACCTTTC -3'

Sequencing Primer
(F):5'- TCAGTGTGCTCTAAGCTCAAG -3'
(R):5'- GGTAGACAAGCCAACCTTTCTCTTTC -3'

Posted On

2021-01-18