Mutagenetix > Incidental Mutation

Incidental Mutation 'R8487:Plekhh2'

657821

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R8487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84557481 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 99 (D99G)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047206
AA Change: D99G

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: D99G

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,859,486	I153V	probably benign	Het
Arhgap21	A	C	2: 20,881,305	S354A	probably benign	Het
Bcan	T	C	3: 87,989,209	T727A	probably damaging	Het
Brinp1	C	T	4: 68,829,455	G137E	probably damaging	Het
Catsperd	A	G	17: 56,663,419	Y697C	probably damaging	Het
Ccdc39	T	A	3: 33,832,659	K267*	probably null	Het
Ccdc47	C	A	11: 106,202,145	V92L	possibly damaging	Het
Cyp2c54	A	T	19: 40,071,546	I181N	probably damaging	Het
Ddx60	A	T	8: 61,974,150	D753V	probably damaging	Het
Dlg2	A	T	7: 92,286,588	K641N	probably damaging	Het
Eloa	G	A	4: 136,009,357	R527C	probably benign	Het
Fancd2	C	T	6: 113,568,226	P835L	probably damaging	Het
Fbln2	C	G	6: 91,250,864	T428S	probably damaging	Het
Fbn2	G	A	18: 58,020,390	A2600V	possibly damaging	Het
Gbe1	A	G	16: 70,436,988	Y251C	probably damaging	Het
Gnptab	T	A	10: 88,432,646		probably null	Het
Hspa1a	T	A	17: 34,972,057		probably benign	Het
Ifi204	G	A	1: 173,760,273	P107S	probably damaging	Het
Kif6	A	G	17: 49,671,136	I119V	probably damaging	Het
Lmntd2	G	A	7: 141,210,514	H554Y	probably benign	Het
Lrrc8e	C	A	8: 4,234,218	H148N	probably damaging	Het
Lrriq1	T	C	10: 103,215,053	N613D	probably damaging	Het
Map4k4	C	T	1: 39,988,976	T319M	probably damaging	Het
Mbtps1	C	T	8: 119,541,674	V253I	probably damaging	Het
Mcm4	C	A	16: 15,632,178	C330F	probably damaging	Het
Mok	A	G	12: 110,809,907		probably null	Het
Nedd4	T	C	9: 72,670,039	C49R	probably damaging	Het
Nlrp4e	T	C	7: 23,321,558	V490A	probably benign	Het
Nsf	A	T	11: 103,928,758	F27I	probably damaging	Het
Olfr1256	T	C	2: 89,835,265	N227D	probably benign	Het
Olfr1513	A	T	14: 52,349,239	L269Q	probably damaging	Het
Olfr301	A	G	7: 86,412,439	S26G	probably benign	Het
Olfr498	G	T	7: 108,465,577	M84I	possibly damaging	Het
Olfr798	A	G	10: 129,625,245	I272T	possibly damaging	Het
Pax1	A	G	2: 147,365,048	M1V	probably null	Het
Pcdhga12	A	G	18: 37,767,578	T488A	probably damaging	Het
Polr3h	T	C	15: 81,916,623	T173A	probably benign	Het
Pramel6	C	T	2: 87,508,701	L82F	probably damaging	Het
Ralgapa2	A	T	2: 146,388,543	I1034N	probably damaging	Het
Rbfox1	G	A	16: 7,224,455	V58I	probably damaging	Het
Reln	T	A	5: 21,899,029	I3315L	probably benign	Het
Rev3l	T	A	10: 39,806,848	S321T	probably damaging	Het
Ryr1	T	C	7: 29,040,867	T3908A	probably damaging	Het
Secisbp2l	G	T	2: 125,775,582	Y58*	probably null	Het
Sgms1	C	A	19: 32,125,297	V337L	probably benign	Het
Slc38a2	G	A	15: 96,695,291	Q136*	probably null	Het
Smarcd1	T	A	15: 99,707,776	V296D	probably damaging	Het
Smcr8	A	C	11: 60,783,996	H866P	probably damaging	Het
Spcs1	T	A	14: 31,000,764	I33L	probably benign	Het
Stxbp5	T	C	10: 9,812,289	R423G	possibly damaging	Het
Syt4	A	T	18: 31,443,737	M188K	possibly damaging	Het
Tchhl1	A	G	3: 93,469,562	D22G	probably damaging	Het
Tiparp	T	A	3: 65,546,234	N134K	probably benign	Het
Topaz1	A	G	9: 122,749,936	D637G	possibly damaging	Het
Trav14d-3-dv8	A	T	14: 53,078,735		probably benign	Het
Vmn1r19	A	T	6: 57,405,181	M240L	probably benign	Het
Vmn1r77	T	A	7: 12,041,587	S29T	probably damaging	Het
Vps13d	A	G	4: 145,155,247	F1253L	probably benign	Het
Zfp407	G	A	18: 84,562,770	R73*	probably null	Het
Zfp446	T	A	7: 12,982,628	F334I	possibly damaging	Het
Zfp654	A	T	16: 64,785,648	Y730*	probably null	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9047:Plekhh2	UTSW	17	84590762	missense	probably damaging	0.99
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign
R9516:Plekhh2	UTSW	17	84610812	missense	probably benign	0.00
R9559:Plekhh2	UTSW	17	84591589	missense	probably damaging	1.00
R9589:Plekhh2	UTSW	17	84547490	missense	possibly damaging	0.90
R9641:Plekhh2	UTSW	17	84566702	missense	probably damaging	1.00
R9659:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95
R9788:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGTCTGCGATACGTTTTAAGAACC -3'
(R):5'- GGAATGACCTCTTACCTGTACCTC -3'

Sequencing Primer
(F):5'- AGTGCAGTTCTAAGCTTAAACTGCTG -3'
(R):5'- TGTACCTCTTACCAAACCATGTGAC -3'

Posted On

2021-01-18