Mutagenetix > Incidental Mutation

Incidental Mutation 'R8487:Syt4'

657822

Institutional Source

Beutler Lab

Gene Symbol

Syt4

Ensembl Gene

ENSMUSG00000024261

Gene Name

synaptotagmin IV

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_009308; MGI: 101759

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8487 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31437808-31447415 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31443737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 188 (M188K)

Ref Sequence

ENSEMBL: ENSMUSP00000025110 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025110]

AlphaFold

P40749

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025110
AA Change: M188K

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000025110
Gene: ENSMUSG00000024261
AA Change: M188K

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
low complexity region	68	79	N/A	INTRINSIC
low complexity region	137	150	N/A	INTRINSIC
C2	169	273	1.5e-19	SMART
C2	303	417	3.5e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the synaptotagmin family. Members of this family are multi-domained, integral membrane proteins of synaptic vesicles, and are thought to serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. This gene is primarily expressed in the nervous tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impairments in motor coordination, contextual fear conditioning, and social transmission of food preference. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl2	T	C	3: 148,859,486	I153V	probably benign	Het
Arhgap21	A	C	2: 20,881,305	S354A	probably benign	Het
Bcan	T	C	3: 87,989,209	T727A	probably damaging	Het
Brinp1	C	T	4: 68,829,455	G137E	probably damaging	Het
Catsperd	A	G	17: 56,663,419	Y697C	probably damaging	Het
Ccdc39	T	A	3: 33,832,659	K267*	probably null	Het
Ccdc47	C	A	11: 106,202,145	V92L	possibly damaging	Het
Cyp2c54	A	T	19: 40,071,546	I181N	probably damaging	Het
Ddx60	A	T	8: 61,974,150	D753V	probably damaging	Het
Dlg2	A	T	7: 92,286,588	K641N	probably damaging	Het
Eloa	G	A	4: 136,009,357	R527C	probably benign	Het
Fancd2	C	T	6: 113,568,226	P835L	probably damaging	Het
Fbln2	C	G	6: 91,250,864	T428S	probably damaging	Het
Fbn2	G	A	18: 58,020,390	A2600V	possibly damaging	Het
Gbe1	A	G	16: 70,436,988	Y251C	probably damaging	Het
Gnptab	T	A	10: 88,432,646		probably null	Het
Hspa1a	T	A	17: 34,972,057		probably benign	Het
Ifi204	G	A	1: 173,760,273	P107S	probably damaging	Het
Kif6	A	G	17: 49,671,136	I119V	probably damaging	Het
Lmntd2	G	A	7: 141,210,514	H554Y	probably benign	Het
Lrrc8e	C	A	8: 4,234,218	H148N	probably damaging	Het
Lrriq1	T	C	10: 103,215,053	N613D	probably damaging	Het
Map4k4	C	T	1: 39,988,976	T319M	probably damaging	Het
Mbtps1	C	T	8: 119,541,674	V253I	probably damaging	Het
Mcm4	C	A	16: 15,632,178	C330F	probably damaging	Het
Mok	A	G	12: 110,809,907		probably null	Het
Nedd4	T	C	9: 72,670,039	C49R	probably damaging	Het
Nlrp4e	T	C	7: 23,321,558	V490A	probably benign	Het
Nsf	A	T	11: 103,928,758	F27I	probably damaging	Het
Olfr1256	T	C	2: 89,835,265	N227D	probably benign	Het
Olfr1513	A	T	14: 52,349,239	L269Q	probably damaging	Het
Olfr301	A	G	7: 86,412,439	S26G	probably benign	Het
Olfr498	G	T	7: 108,465,577	M84I	possibly damaging	Het
Olfr798	A	G	10: 129,625,245	I272T	possibly damaging	Het
Pax1	A	G	2: 147,365,048	M1V	probably null	Het
Pcdhga12	A	G	18: 37,767,578	T488A	probably damaging	Het
Plekhh2	A	G	17: 84,557,481	D99G	possibly damaging	Het
Polr3h	T	C	15: 81,916,623	T173A	probably benign	Het
Pramel6	C	T	2: 87,508,701	L82F	probably damaging	Het
Ralgapa2	A	T	2: 146,388,543	I1034N	probably damaging	Het
Rbfox1	G	A	16: 7,224,455	V58I	probably damaging	Het
Reln	T	A	5: 21,899,029	I3315L	probably benign	Het
Rev3l	T	A	10: 39,806,848	S321T	probably damaging	Het
Ryr1	T	C	7: 29,040,867	T3908A	probably damaging	Het
Secisbp2l	G	T	2: 125,775,582	Y58*	probably null	Het
Sgms1	C	A	19: 32,125,297	V337L	probably benign	Het
Slc38a2	G	A	15: 96,695,291	Q136*	probably null	Het
Smarcd1	T	A	15: 99,707,776	V296D	probably damaging	Het
Smcr8	A	C	11: 60,783,996	H866P	probably damaging	Het
Spcs1	T	A	14: 31,000,764	I33L	probably benign	Het
Stxbp5	T	C	10: 9,812,289	R423G	possibly damaging	Het
Tchhl1	A	G	3: 93,469,562	D22G	probably damaging	Het
Tiparp	T	A	3: 65,546,234	N134K	probably benign	Het
Topaz1	A	G	9: 122,749,936	D637G	possibly damaging	Het
Trav14d-3-dv8	A	T	14: 53,078,735		probably benign	Het
Vmn1r19	A	T	6: 57,405,181	M240L	probably benign	Het
Vmn1r77	T	A	7: 12,041,587	S29T	probably damaging	Het
Vps13d	A	G	4: 145,155,247	F1253L	probably benign	Het
Zfp407	G	A	18: 84,562,770	R73*	probably null	Het
Zfp446	T	A	7: 12,982,628	F334I	possibly damaging	Het
Zfp654	A	T	16: 64,785,648	Y730*	probably null	Het

Other mutations in Syt4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00971:Syt4	APN	18	31447174	utr 5 prime	probably benign
IGL01476:Syt4	APN	18	31441643	missense	probably damaging	1.00
IGL02412:Syt4	APN	18	31443843	missense	probably benign	0.19
IGL02550:Syt4	APN	18	31444193	missense	probably damaging	1.00
IGL02996:Syt4	APN	18	31444146	missense	probably damaging	1.00
F6893:Syt4	UTSW	18	31444221	missense	possibly damaging	0.74
PIT4434001:Syt4	UTSW	18	31440331	missense	probably damaging	1.00
R0103:Syt4	UTSW	18	31447220	start gained	probably benign
R0526:Syt4	UTSW	18	31443746	missense	possibly damaging	0.95
R1122:Syt4	UTSW	18	31440202	missense	probably damaging	1.00
R1622:Syt4	UTSW	18	31444016	missense	probably damaging	1.00
R1786:Syt4	UTSW	18	31443443	splice site	probably benign
R1895:Syt4	UTSW	18	31444088	missense	probably damaging	1.00
R2114:Syt4	UTSW	18	31440467	missense	probably damaging	1.00
R2117:Syt4	UTSW	18	31440467	missense	probably damaging	1.00
R2655:Syt4	UTSW	18	31443544	missense	probably benign	0.01
R3079:Syt4	UTSW	18	31441685	missense	probably benign	0.08
R3730:Syt4	UTSW	18	31444136	missense	probably damaging	0.96
R4870:Syt4	UTSW	18	31447356	start gained	probably benign
R7638:Syt4	UTSW	18	31443822	missense	probably benign	0.20
R7646:Syt4	UTSW	18	31441605	missense	possibly damaging	0.95
R7746:Syt4	UTSW	18	31444265	missense	probably benign	0.02
R7799:Syt4	UTSW	18	31440192	nonsense	probably null
R8174:Syt4	UTSW	18	31444177	missense	probably benign	0.00
R8199:Syt4	UTSW	18	31444215	missense	probably benign	0.30
R8428:Syt4	UTSW	18	31444019	missense	probably damaging	1.00
R8436:Syt4	UTSW	18	31440419	missense	possibly damaging	0.93
Y5404:Syt4	UTSW	18	31443791	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAATCCCTGAAAGAGGAATCAG -3'
(R):5'- AAAGGAGGCCAATTCCCCTG -3'

Sequencing Primer
(F):5'- AGGAATCAGGACTTCTCCAATG -3'
(R):5'- AATTCCCCTGAGAGCTTGAAGTC -3'

Posted On

2021-01-18