Incidental Mutation 'R8487:Cyp2c54'
ID 657827
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R8487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 40037941-40073811 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40071546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 181 (I181N)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably damaging
Transcript: ENSMUST00000048959
AA Change: I181N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: I181N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,859,486 I153V probably benign Het
Arhgap21 A C 2: 20,881,305 S354A probably benign Het
Bcan T C 3: 87,989,209 T727A probably damaging Het
Brinp1 C T 4: 68,829,455 G137E probably damaging Het
Catsperd A G 17: 56,663,419 Y697C probably damaging Het
Ccdc39 T A 3: 33,832,659 K267* probably null Het
Ccdc47 C A 11: 106,202,145 V92L possibly damaging Het
Ddx60 A T 8: 61,974,150 D753V probably damaging Het
Dlg2 A T 7: 92,286,588 K641N probably damaging Het
Eloa G A 4: 136,009,357 R527C probably benign Het
Fancd2 C T 6: 113,568,226 P835L probably damaging Het
Fbln2 C G 6: 91,250,864 T428S probably damaging Het
Fbn2 G A 18: 58,020,390 A2600V possibly damaging Het
Gbe1 A G 16: 70,436,988 Y251C probably damaging Het
Gnptab T A 10: 88,432,646 probably null Het
Hspa1a T A 17: 34,972,057 probably benign Het
Ifi204 G A 1: 173,760,273 P107S probably damaging Het
Kif6 A G 17: 49,671,136 I119V probably damaging Het
Lmntd2 G A 7: 141,210,514 H554Y probably benign Het
Lrrc8e C A 8: 4,234,218 H148N probably damaging Het
Lrriq1 T C 10: 103,215,053 N613D probably damaging Het
Map4k4 C T 1: 39,988,976 T319M probably damaging Het
Mbtps1 C T 8: 119,541,674 V253I probably damaging Het
Mcm4 C A 16: 15,632,178 C330F probably damaging Het
Mok A G 12: 110,809,907 probably null Het
Nedd4 T C 9: 72,670,039 C49R probably damaging Het
Nlrp4e T C 7: 23,321,558 V490A probably benign Het
Nsf A T 11: 103,928,758 F27I probably damaging Het
Olfr1256 T C 2: 89,835,265 N227D probably benign Het
Olfr1513 A T 14: 52,349,239 L269Q probably damaging Het
Olfr301 A G 7: 86,412,439 S26G probably benign Het
Olfr498 G T 7: 108,465,577 M84I possibly damaging Het
Olfr798 A G 10: 129,625,245 I272T possibly damaging Het
Pax1 A G 2: 147,365,048 M1V probably null Het
Pcdhga12 A G 18: 37,767,578 T488A probably damaging Het
Plekhh2 A G 17: 84,557,481 D99G possibly damaging Het
Polr3h T C 15: 81,916,623 T173A probably benign Het
Pramel6 C T 2: 87,508,701 L82F probably damaging Het
Ralgapa2 A T 2: 146,388,543 I1034N probably damaging Het
Rbfox1 G A 16: 7,224,455 V58I probably damaging Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rev3l T A 10: 39,806,848 S321T probably damaging Het
Ryr1 T C 7: 29,040,867 T3908A probably damaging Het
Secisbp2l G T 2: 125,775,582 Y58* probably null Het
Sgms1 C A 19: 32,125,297 V337L probably benign Het
Slc38a2 G A 15: 96,695,291 Q136* probably null Het
Smarcd1 T A 15: 99,707,776 V296D probably damaging Het
Smcr8 A C 11: 60,783,996 H866P probably damaging Het
Spcs1 T A 14: 31,000,764 I33L probably benign Het
Stxbp5 T C 10: 9,812,289 R423G possibly damaging Het
Syt4 A T 18: 31,443,737 M188K possibly damaging Het
Tchhl1 A G 3: 93,469,562 D22G probably damaging Het
Tiparp T A 3: 65,546,234 N134K probably benign Het
Topaz1 A G 9: 122,749,936 D637G possibly damaging Het
Trav14d-3-dv8 A T 14: 53,078,735 probably benign Het
Vmn1r19 A T 6: 57,405,181 M240L probably benign Het
Vmn1r77 T A 7: 12,041,587 S29T probably damaging Het
Vps13d A G 4: 145,155,247 F1253L probably benign Het
Zfp407 G A 18: 84,562,770 R73* probably null Het
Zfp446 T A 7: 12,982,628 F334I possibly damaging Het
Zfp654 A T 16: 64,785,648 Y730* probably null Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40072078 missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40047543 missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40072365 critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40070228 missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40047658 splice site probably benign
R0097:Cyp2c54 UTSW 19 40047659 splice site probably benign
R0391:Cyp2c54 UTSW 19 40072169 missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40047555 missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40047635 missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40046185 missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40047588 missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40070343 missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40072423 missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40046255 missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40072171 missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40038259 missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40072141 missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40072474 missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40072414 missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40073762 missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40047561 missense probably benign
R6754:Cyp2c54 UTSW 19 40071560 missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40070259 missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40046192 missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40046182 missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40047509 missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40070253 nonsense probably null
R7535:Cyp2c54 UTSW 19 40070272 missense probably benign
R7838:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40073732 frame shift probably null
R8275:Cyp2c54 UTSW 19 40038305 missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40072387 missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40073681 missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40070264 missense probably benign 0.43
R8519:Cyp2c54 UTSW 19 40038413 missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40047586 missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40073783 missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40047506 missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40072494 nonsense probably null
R9470:Cyp2c54 UTSW 19 40072444 missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40046081 missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40046215 missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40073757 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACGTTAGTCAGAACTGTCACG -3'
(R):5'- AGCCATGCATTGCCCTTAGC -3'

Sequencing Primer
(F):5'- AGTCAGAACTGTCACGTCTGGTC -3'
(R):5'- GCCCTTAGCATAAATGTAGCATAG -3'
Posted On 2021-01-18