Incidental Mutation 'R8487:Cyp2c54'
ID 657827
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 067930-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8487 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40059990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 181 (I181N)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably damaging
Transcript: ENSMUST00000048959
AA Change: I181N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: I181N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,565,122 (GRCm39) I153V probably benign Het
Arhgap21 A C 2: 20,886,116 (GRCm39) S354A probably benign Het
Bcan T C 3: 87,896,516 (GRCm39) T727A probably damaging Het
Brinp1 C T 4: 68,747,692 (GRCm39) G137E probably damaging Het
Catsperd A G 17: 56,970,419 (GRCm39) Y697C probably damaging Het
Ccdc39 T A 3: 33,886,808 (GRCm39) K267* probably null Het
Ccdc47 C A 11: 106,092,971 (GRCm39) V92L possibly damaging Het
Ddx60 A T 8: 62,427,184 (GRCm39) D753V probably damaging Het
Dlg2 A T 7: 91,935,796 (GRCm39) K641N probably damaging Het
Eloa G A 4: 135,736,668 (GRCm39) R527C probably benign Het
Fancd2 C T 6: 113,545,187 (GRCm39) P835L probably damaging Het
Fbln2 C G 6: 91,227,846 (GRCm39) T428S probably damaging Het
Fbn2 G A 18: 58,153,462 (GRCm39) A2600V possibly damaging Het
Gbe1 A G 16: 70,233,876 (GRCm39) Y251C probably damaging Het
Gnptab T A 10: 88,268,508 (GRCm39) probably null Het
Hspa1a T A 17: 35,191,033 (GRCm39) probably benign Het
Ifi204 G A 1: 173,587,839 (GRCm39) P107S probably damaging Het
Kif6 A G 17: 49,978,164 (GRCm39) I119V probably damaging Het
Lmntd2 G A 7: 140,790,427 (GRCm39) H554Y probably benign Het
Lrrc8e C A 8: 4,284,218 (GRCm39) H148N probably damaging Het
Lrriq1 T C 10: 103,050,914 (GRCm39) N613D probably damaging Het
Map4k4 C T 1: 40,028,136 (GRCm39) T319M probably damaging Het
Mbtps1 C T 8: 120,268,413 (GRCm39) V253I probably damaging Het
Mcm4 C A 16: 15,450,042 (GRCm39) C330F probably damaging Het
Mok A G 12: 110,776,341 (GRCm39) probably null Het
Nedd4 T C 9: 72,577,321 (GRCm39) C49R probably damaging Het
Nlrp4e T C 7: 23,020,983 (GRCm39) V490A probably benign Het
Nsf A T 11: 103,819,584 (GRCm39) F27I probably damaging Het
Or10g3b A T 14: 52,586,696 (GRCm39) L269Q probably damaging Het
Or14c44 A G 7: 86,061,647 (GRCm39) S26G probably benign Het
Or4a47 T C 2: 89,665,609 (GRCm39) N227D probably benign Het
Or5p73 G T 7: 108,064,784 (GRCm39) M84I possibly damaging Het
Or6c66 A G 10: 129,461,114 (GRCm39) I272T possibly damaging Het
Pax1 A G 2: 147,206,968 (GRCm39) M1V probably null Het
Pcdhga12 A G 18: 37,900,631 (GRCm39) T488A probably damaging Het
Plekhh2 A G 17: 84,864,909 (GRCm39) D99G possibly damaging Het
Polr3h T C 15: 81,800,824 (GRCm39) T173A probably benign Het
Pramel6 C T 2: 87,339,045 (GRCm39) L82F probably damaging Het
Ralgapa2 A T 2: 146,230,463 (GRCm39) I1034N probably damaging Het
Rbfox1 G A 16: 7,042,319 (GRCm39) V58I probably damaging Het
Reln T A 5: 22,104,027 (GRCm39) I3315L probably benign Het
Rev3l T A 10: 39,682,844 (GRCm39) S321T probably damaging Het
Ryr1 T C 7: 28,740,292 (GRCm39) T3908A probably damaging Het
Secisbp2l G T 2: 125,617,502 (GRCm39) Y58* probably null Het
Sgms1 C A 19: 32,102,697 (GRCm39) V337L probably benign Het
Slc38a2 G A 15: 96,593,172 (GRCm39) Q136* probably null Het
Smarcd1 T A 15: 99,605,657 (GRCm39) V296D probably damaging Het
Smcr8 A C 11: 60,674,822 (GRCm39) H866P probably damaging Het
Spcs1 T A 14: 30,722,721 (GRCm39) I33L probably benign Het
Stxbp5 T C 10: 9,688,033 (GRCm39) R423G possibly damaging Het
Syt4 A T 18: 31,576,790 (GRCm39) M188K possibly damaging Het
Tchhl1 A G 3: 93,376,869 (GRCm39) D22G probably damaging Het
Tiparp T A 3: 65,453,655 (GRCm39) N134K probably benign Het
Topaz1 A G 9: 122,579,001 (GRCm39) D637G possibly damaging Het
Trav14d-3-dv8 A T 14: 53,316,192 (GRCm39) probably benign Het
Vmn1r19 A T 6: 57,382,166 (GRCm39) M240L probably benign Het
Vmn1r77 T A 7: 11,775,514 (GRCm39) S29T probably damaging Het
Vps13d A G 4: 144,881,817 (GRCm39) F1253L probably benign Het
Zfp407 G A 18: 84,580,895 (GRCm39) R73* probably null Het
Zfp446 T A 7: 12,716,555 (GRCm39) F334I possibly damaging Het
Zfp654 A T 16: 64,606,011 (GRCm39) Y730* probably null Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACGTTAGTCAGAACTGTCACG -3'
(R):5'- AGCCATGCATTGCCCTTAGC -3'

Sequencing Primer
(F):5'- AGTCAGAACTGTCACGTCTGGTC -3'
(R):5'- GCCCTTAGCATAAATGTAGCATAG -3'
Posted On 2021-01-18