Incidental Mutation 'R8489:Dennd5b'
ID 657885
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 067932-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 148986389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 58 (D58V)
Ref Sequence ENSEMBL: ENSMUSP00000123568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557] [ENSMUST00000127727] [ENSMUST00000145555]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127727
AA Change: D58V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123568
Gene: ENSMUSG00000030313
AA Change: D58V

DomainStartEndE-ValueType
uDENN 18 142 5.45e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145555
SMART Domains Protein: ENSMUSP00000127731
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 1 42 3.03e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,777,254 (GRCm39) probably benign Het
Apc2 T G 10: 80,143,298 (GRCm39) L466R probably damaging Het
Baz1b C A 5: 135,245,709 (GRCm39) P386H probably damaging Het
Ccdc149 T C 5: 52,533,999 (GRCm39) D389G probably benign Het
Cit T A 5: 116,083,962 (GRCm39) probably null Het
Cmas C A 6: 142,702,596 (GRCm39) A33E probably benign Het
Dcaf7 A G 11: 105,942,743 (GRCm39) N230S probably damaging Het
Dcun1d5 C A 9: 7,206,837 (GRCm39) probably benign Het
Dmrt2 C A 19: 25,655,831 (GRCm39) Q477K probably damaging Het
Eva1c A G 16: 90,672,999 (GRCm39) N90S probably damaging Het
Fcgbp A T 7: 27,804,435 (GRCm39) I1848F possibly damaging Het
Fgfr2 T G 7: 129,769,534 (GRCm39) M522L probably benign Het
Fshr C A 17: 89,293,795 (GRCm39) K294N probably benign Het
Gja10 T C 4: 32,601,866 (GRCm39) I173V probably benign Het
Gmnn A G 13: 24,941,614 (GRCm39) S32P probably damaging Het
Hdac9 T C 12: 34,487,180 (GRCm39) N95D probably damaging Het
Ipo13 T C 4: 117,758,219 (GRCm39) T715A probably damaging Het
Klrc2 A G 6: 129,635,787 (GRCm39) S97P probably benign Het
Lrrn4 G A 2: 132,721,364 (GRCm39) S151L probably benign Het
Man2a1 G T 17: 64,908,765 (GRCm39) S12I possibly damaging Het
Mplkipl1 T C 19: 61,164,085 (GRCm39) T117A probably damaging Het
Mrgprb8 T A 7: 48,038,701 (GRCm39) V124E possibly damaging Het
Myo5c T C 9: 75,180,128 (GRCm39) W690R probably damaging Het
Ncapd2 T C 6: 125,150,745 (GRCm39) K817E probably damaging Het
Or51k2 T C 7: 103,596,328 (GRCm39) I185T probably damaging Het
Or5h27 A G 16: 59,006,400 (GRCm39) *149Q probably null Het
Or5p60 T A 7: 107,724,372 (GRCm39) I33F probably benign Het
Or8b50 T C 9: 38,518,232 (GRCm39) M157T probably benign Het
Pcdh18 A T 3: 49,709,038 (GRCm39) I759N probably damaging Het
Pcdhac2 A T 18: 37,278,207 (GRCm39) N396Y probably damaging Het
Pcm1 T A 8: 41,766,437 (GRCm39) C1542S probably benign Het
Pcsk1 T A 13: 75,274,121 (GRCm39) V450E probably damaging Het
Pld2 A G 11: 70,445,121 (GRCm39) K574E probably damaging Het
Pramel52-ps T C 5: 94,531,551 (GRCm39) L145P probably damaging Het
Psmc1 C T 12: 100,089,356 (GRCm39) R410C probably benign Het
Rad51b C T 12: 79,374,024 (GRCm39) S201L probably benign Het
Rgs3 T A 4: 62,544,733 (GRCm39) L200Q probably damaging Het
Rims2 A G 15: 39,479,846 (GRCm39) M1293V probably damaging Het
Scin C T 12: 40,131,019 (GRCm39) G298D probably damaging Het
Scn8a C A 15: 100,867,014 (GRCm39) F123L probably damaging Het
Snapc3 G A 4: 83,369,531 (GRCm39) C353Y probably damaging Het
Sned1 C A 1: 93,210,978 (GRCm39) S231* probably null Het
Tex15 A G 8: 34,067,574 (GRCm39) T2335A probably benign Het
Tigd4 G A 3: 84,502,526 (GRCm39) G481D probably benign Het
Trank1 T G 9: 111,219,343 (GRCm39) F2027V probably benign Het
Ubr1 C T 2: 120,711,548 (GRCm39) A1449T probably benign Het
Ulk1 G T 5: 110,947,002 (GRCm39) Y89* probably null Het
Usp54 A G 14: 20,611,604 (GRCm39) F1071L probably benign Het
Utrn C T 10: 12,587,190 (GRCm39) E949K probably benign Het
Vmn2r65 T A 7: 84,589,964 (GRCm39) T651S possibly damaging Het
Wdfy1 A G 1: 79,739,368 (GRCm39) L17P probably damaging Het
Zfp672 G A 11: 58,220,681 (GRCm39) probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGACACCTTAGACTGG -3'
(R):5'- TGAACAGTATGTGCGTTTCTTC -3'

Sequencing Primer
(F):5'- GCTTGAAGCAAATGAGGTCTTTATG -3'
(R):5'- CAGTATGTGCGTTTCTTCCATATAG -3'
Posted On 2021-01-18