Mutagenetix > Incidental Mutation

Incidental Mutation 'R8489:Pcsk1'

657908

Institutional Source

Beutler Lab

Gene Symbol

Pcsk1

Ensembl Gene

ENSMUSG00000021587

Gene Name

proprotein convertase subtilisin/kexin type 1

Synonyms

PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8489 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75089826-75134861 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75126002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 450 (V450E)

Ref Sequence

ENSEMBL: ENSMUSP00000022075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022075]

AlphaFold

P63239

PDB Structure

Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022075
AA Change: V450E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: V450E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	T	C	5: 94,383,692	L145P	probably damaging	Het
AI661453	C	A	17: 47,466,329		probably benign	Het
Apc2	T	G	10: 80,307,464	L466R	probably damaging	Het
Baz1b	C	A	5: 135,216,855	P386H	probably damaging	Het
Ccdc149	T	C	5: 52,376,657	D389G	probably benign	Het
Cit	T	A	5: 115,945,903		probably null	Het
Cmas	C	A	6: 142,756,870	A33E	probably benign	Het
Dcaf7	A	G	11: 106,051,917	N230S	probably damaging	Het
Dcun1d5	C	A	9: 7,206,837		probably benign	Het
Dennd5b	T	A	6: 149,084,891	D58V	probably benign	Het
Dmrt2	C	A	19: 25,678,467	Q477K	probably damaging	Het
Eva1c	A	G	16: 90,876,111	N90S	probably damaging	Het
Fcgbp	A	T	7: 28,105,010	I1848F	possibly damaging	Het
Fgfr2	T	G	7: 130,167,804	M522L	probably benign	Het
Fshr	C	A	17: 88,986,367	K294N	probably benign	Het
Gja10	T	C	4: 32,601,866	I173V	probably benign	Het
Gm7102	T	C	19: 61,175,647	T117A	probably damaging	Het
Gmnn	A	G	13: 24,757,631	S32P	probably damaging	Het
Hdac9	T	C	12: 34,437,181	N95D	probably damaging	Het
Ipo13	T	C	4: 117,901,022	T715A	probably damaging	Het
Klrc2	A	G	6: 129,658,824	S97P	probably benign	Het
Lrrn4	G	A	2: 132,879,444	S151L	probably benign	Het
Man2a1	G	T	17: 64,601,770	S12I	possibly damaging	Het
Mrgprb8	T	A	7: 48,388,953	V124E	possibly damaging	Het
Myo5c	T	C	9: 75,272,846	W690R	probably damaging	Het
Ncapd2	T	C	6: 125,173,782	K817E	probably damaging	Het
Olfr197	A	G	16: 59,186,037	*149Q	probably null	Het
Olfr484	T	A	7: 108,125,165	I33F	probably benign	Het
Olfr633	T	C	7: 103,947,121	I185T	probably damaging	Het
Olfr914	T	C	9: 38,606,936	M157T	probably benign	Het
Pcdh18	A	T	3: 49,754,589	I759N	probably damaging	Het
Pcdhac2	A	T	18: 37,145,154	N396Y	probably damaging	Het
Pcm1	T	A	8: 41,313,400	C1542S	probably benign	Het
Pld2	A	G	11: 70,554,295	K574E	probably damaging	Het
Psmc1	C	T	12: 100,123,097	R410C	probably benign	Het
Rad51b	C	T	12: 79,327,250	S201L	probably benign	Het
Rgs3	T	A	4: 62,626,496	L200Q	probably damaging	Het
Rims2	A	G	15: 39,616,450	M1293V	probably damaging	Het
Scin	C	T	12: 40,081,020	G298D	probably damaging	Het
Scn8a	C	A	15: 100,969,133	F123L	probably damaging	Het
Snapc3	G	A	4: 83,451,294	C353Y	probably damaging	Het
Sned1	C	A	1: 93,283,256	S231*	probably null	Het
Tex15	A	G	8: 33,577,546	T2335A	probably benign	Het
Tigd4	G	A	3: 84,595,219	G481D	probably benign	Het
Trank1	T	G	9: 111,390,275	F2027V	probably benign	Het
Ubr1	C	T	2: 120,881,067	A1449T	probably benign	Het
Ulk1	G	T	5: 110,799,136	Y89*	probably null	Het
Usp54	A	G	14: 20,561,536	F1071L	probably benign	Het
Utrn	C	T	10: 12,711,446	E949K	probably benign	Het
Vmn2r65	T	A	7: 84,940,756	T651S	possibly damaging	Het
Wdfy1	A	G	1: 79,761,651	L17P	probably damaging	Het
Zfp672	G	A	11: 58,329,855		probably benign	Het

Other mutations in Pcsk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Pcsk1	APN	13	75132087	missense	probably benign
IGL01554:Pcsk1	APN	13	75132307	missense	probably benign
IGL01960:Pcsk1	APN	13	75093167	missense	possibly damaging	0.82
IGL02026:Pcsk1	APN	13	75112653	missense	probably benign	0.16
IGL02047:Pcsk1	APN	13	75097989	missense	probably benign	0.33
IGL02264:Pcsk1	APN	13	75105959	missense	probably damaging	1.00
IGL02441:Pcsk1	APN	13	75132163	missense	probably benign	0.16
IGL02795:Pcsk1	APN	13	75112620	missense	probably damaging	1.00
IGL02829:Pcsk1	APN	13	75126836	missense	probably damaging	1.00
IGL03116:Pcsk1	APN	13	75132216	missense	probably damaging	0.99
IGL03156:Pcsk1	APN	13	75131951	missense	probably benign
clipper	UTSW	13	75130070	missense	probably damaging	1.00
spareribs	UTSW	13	75115255	missense	possibly damaging	0.88
swivel	UTSW	13	75125984	missense	probably damaging	1.00
Tweeze	UTSW	13	75126839	missense	probably benign	0.00
PIT4453001:Pcsk1	UTSW	13	75112650	missense	probably damaging	1.00
R0771:Pcsk1	UTSW	13	75132162	missense	probably benign	0.31
R0894:Pcsk1	UTSW	13	75097977	missense	probably damaging	1.00
R1014:Pcsk1	UTSW	13	75132234	missense	probably damaging	1.00
R1035:Pcsk1	UTSW	13	75132119	missense	probably benign
R1199:Pcsk1	UTSW	13	75096413	splice site	probably benign
R1517:Pcsk1	UTSW	13	75098047	nonsense	probably null
R1625:Pcsk1	UTSW	13	75126852	missense	probably benign	0.11
R1691:Pcsk1	UTSW	13	75132225	missense	possibly damaging	0.65
R1717:Pcsk1	UTSW	13	75110828	missense	probably damaging	0.99
R2168:Pcsk1	UTSW	13	75112534	intron	probably benign
R2252:Pcsk1	UTSW	13	75126726	missense	probably benign	0.00
R2400:Pcsk1	UTSW	13	75090126	missense	probably benign	0.00
R4110:Pcsk1	UTSW	13	75096369	missense	probably damaging	0.99
R4358:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4359:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4657:Pcsk1	UTSW	13	75132235	missense	probably damaging	1.00
R5195:Pcsk1	UTSW	13	75126855	missense	probably damaging	1.00
R5669:Pcsk1	UTSW	13	75130102	missense	probably benign	0.01
R5671:Pcsk1	UTSW	13	75097907	missense	possibly damaging	0.63
R5745:Pcsk1	UTSW	13	75131960	missense	probably benign	0.03
R6107:Pcsk1	UTSW	13	75127848	missense	probably benign	0.09
R6200:Pcsk1	UTSW	13	75115255	missense	possibly damaging	0.88
R6326:Pcsk1	UTSW	13	75132179	missense	possibly damaging	0.89
R6537:Pcsk1	UTSW	13	75132239	missense	probably damaging	1.00
R6541:Pcsk1	UTSW	13	75125984	missense	probably damaging	1.00
R6567:Pcsk1	UTSW	13	75130070	missense	probably damaging	1.00
R6723:Pcsk1	UTSW	13	75093069	splice site	probably null
R7258:Pcsk1	UTSW	13	75093186	missense	probably damaging	1.00
R7357:Pcsk1	UTSW	13	75125960	missense	probably damaging	0.96
R7487:Pcsk1	UTSW	13	75110883	missense	probably benign	0.01
R7519:Pcsk1	UTSW	13	75110865	missense	probably damaging	0.99
R7647:Pcsk1	UTSW	13	75132210	missense	possibly damaging	0.73
R7787:Pcsk1	UTSW	13	75132158	missense	possibly damaging	0.88
R7944:Pcsk1	UTSW	13	75132092	missense	probably benign
R7945:Pcsk1	UTSW	13	75132092	missense	probably benign
R7961:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8009:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8022:Pcsk1	UTSW	13	75099293	missense	possibly damaging	0.77
R8171:Pcsk1	UTSW	13	75090091	nonsense	probably null
R9310:Pcsk1	UTSW	13	75090072	missense	probably benign
R9404:Pcsk1	UTSW	13	75132223	missense	probably benign	0.11
R9544:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9588:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9706:Pcsk1	UTSW	13	75099354	critical splice donor site	probably null
Z1176:Pcsk1	UTSW	13	75098042	missense	probably damaging	1.00
Z1177:Pcsk1	UTSW	13	75125864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGATACTTTGGGTCACTTTCTCC -3'
(R):5'- TCCTGACTACCCATAGAGACAG -3'

Sequencing Primer
(F):5'- CCTAGCCCAAATCTTACCTGGAGAG -3'
(R):5'- CTGAGTCCATCTATTACAGAAGAGC -3'

Posted On

2021-01-18