Incidental Mutation 'R8489:Eva1c'
ID 657913
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Name eva-1 homolog C
Synonyms 4931408A02Rik, 1700092M14Rik, Fam176c
MMRRC Submission 067932-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 90623607-90701997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90672999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 90 (N90S)
Ref Sequence ENSEMBL: ENSMUSP00000155994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000154180] [ENSMUST00000231280] [ENSMUST00000231964]
AlphaFold P58659
Predicted Effect probably damaging
Transcript: ENSMUST00000037539
AA Change: N185S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: N185S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099543
AA Change: N185S

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: N185S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099548
AA Change: N191S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: N191S

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154180
AA Change: N90S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119830
Gene: ENSMUSG00000039903
AA Change: N90S

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 2.9e-13 PFAM
Pfam:Gal_Lectin 81 145 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231280
AA Change: N78S

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably damaging
Transcript: ENSMUST00000231964
AA Change: N90S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,777,254 (GRCm39) probably benign Het
Apc2 T G 10: 80,143,298 (GRCm39) L466R probably damaging Het
Baz1b C A 5: 135,245,709 (GRCm39) P386H probably damaging Het
Ccdc149 T C 5: 52,533,999 (GRCm39) D389G probably benign Het
Cit T A 5: 116,083,962 (GRCm39) probably null Het
Cmas C A 6: 142,702,596 (GRCm39) A33E probably benign Het
Dcaf7 A G 11: 105,942,743 (GRCm39) N230S probably damaging Het
Dcun1d5 C A 9: 7,206,837 (GRCm39) probably benign Het
Dennd5b T A 6: 148,986,389 (GRCm39) D58V probably benign Het
Dmrt2 C A 19: 25,655,831 (GRCm39) Q477K probably damaging Het
Fcgbp A T 7: 27,804,435 (GRCm39) I1848F possibly damaging Het
Fgfr2 T G 7: 129,769,534 (GRCm39) M522L probably benign Het
Fshr C A 17: 89,293,795 (GRCm39) K294N probably benign Het
Gja10 T C 4: 32,601,866 (GRCm39) I173V probably benign Het
Gmnn A G 13: 24,941,614 (GRCm39) S32P probably damaging Het
Hdac9 T C 12: 34,487,180 (GRCm39) N95D probably damaging Het
Ipo13 T C 4: 117,758,219 (GRCm39) T715A probably damaging Het
Klrc2 A G 6: 129,635,787 (GRCm39) S97P probably benign Het
Lrrn4 G A 2: 132,721,364 (GRCm39) S151L probably benign Het
Man2a1 G T 17: 64,908,765 (GRCm39) S12I possibly damaging Het
Mplkipl1 T C 19: 61,164,085 (GRCm39) T117A probably damaging Het
Mrgprb8 T A 7: 48,038,701 (GRCm39) V124E possibly damaging Het
Myo5c T C 9: 75,180,128 (GRCm39) W690R probably damaging Het
Ncapd2 T C 6: 125,150,745 (GRCm39) K817E probably damaging Het
Or51k2 T C 7: 103,596,328 (GRCm39) I185T probably damaging Het
Or5h27 A G 16: 59,006,400 (GRCm39) *149Q probably null Het
Or5p60 T A 7: 107,724,372 (GRCm39) I33F probably benign Het
Or8b50 T C 9: 38,518,232 (GRCm39) M157T probably benign Het
Pcdh18 A T 3: 49,709,038 (GRCm39) I759N probably damaging Het
Pcdhac2 A T 18: 37,278,207 (GRCm39) N396Y probably damaging Het
Pcm1 T A 8: 41,766,437 (GRCm39) C1542S probably benign Het
Pcsk1 T A 13: 75,274,121 (GRCm39) V450E probably damaging Het
Pld2 A G 11: 70,445,121 (GRCm39) K574E probably damaging Het
Pramel52-ps T C 5: 94,531,551 (GRCm39) L145P probably damaging Het
Psmc1 C T 12: 100,089,356 (GRCm39) R410C probably benign Het
Rad51b C T 12: 79,374,024 (GRCm39) S201L probably benign Het
Rgs3 T A 4: 62,544,733 (GRCm39) L200Q probably damaging Het
Rims2 A G 15: 39,479,846 (GRCm39) M1293V probably damaging Het
Scin C T 12: 40,131,019 (GRCm39) G298D probably damaging Het
Scn8a C A 15: 100,867,014 (GRCm39) F123L probably damaging Het
Snapc3 G A 4: 83,369,531 (GRCm39) C353Y probably damaging Het
Sned1 C A 1: 93,210,978 (GRCm39) S231* probably null Het
Tex15 A G 8: 34,067,574 (GRCm39) T2335A probably benign Het
Tigd4 G A 3: 84,502,526 (GRCm39) G481D probably benign Het
Trank1 T G 9: 111,219,343 (GRCm39) F2027V probably benign Het
Ubr1 C T 2: 120,711,548 (GRCm39) A1449T probably benign Het
Ulk1 G T 5: 110,947,002 (GRCm39) Y89* probably null Het
Usp54 A G 14: 20,611,604 (GRCm39) F1071L probably benign Het
Utrn C T 10: 12,587,190 (GRCm39) E949K probably benign Het
Vmn2r65 T A 7: 84,589,964 (GRCm39) T651S possibly damaging Het
Wdfy1 A G 1: 79,739,368 (GRCm39) L17P probably damaging Het
Zfp672 G A 11: 58,220,681 (GRCm39) probably benign Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90,701,235 (GRCm39) missense probably damaging 1.00
IGL02061:Eva1c APN 16 90,663,163 (GRCm39) nonsense probably null
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90,672,986 (GRCm39) missense probably benign 0.03
R1330:Eva1c UTSW 16 90,701,284 (GRCm39) missense probably damaging 1.00
R1765:Eva1c UTSW 16 90,701,135 (GRCm39) missense probably benign 0.01
R1824:Eva1c UTSW 16 90,663,331 (GRCm39) missense probably benign 0.01
R1880:Eva1c UTSW 16 90,694,303 (GRCm39) missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90,628,213 (GRCm39) missense probably benign 0.12
R4072:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4076:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4622:Eva1c UTSW 16 90,694,343 (GRCm39) critical splice donor site probably null
R4760:Eva1c UTSW 16 90,701,138 (GRCm39) missense probably benign 0.37
R4767:Eva1c UTSW 16 90,701,235 (GRCm39) missense probably damaging 1.00
R5024:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R5304:Eva1c UTSW 16 90,666,551 (GRCm39) missense probably damaging 1.00
R5559:Eva1c UTSW 16 90,701,139 (GRCm39) missense probably benign 0.06
R6605:Eva1c UTSW 16 90,663,236 (GRCm39) missense probably damaging 1.00
R7222:Eva1c UTSW 16 90,701,072 (GRCm39) small deletion probably benign
R7409:Eva1c UTSW 16 90,666,544 (GRCm39) missense probably damaging 1.00
R7449:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R8687:Eva1c UTSW 16 90,687,433 (GRCm39) missense probably benign 0.42
R9091:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
R9270:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGGGTTGATTATATTAAAAGCCATCCC -3'
(R):5'- GCCGGTACAAGCCACATTTC -3'

Sequencing Primer
(F):5'- AGAGTCTCATATATTCCCAACGGTC -3'
(R):5'- GGTACAAGCCACATTTCATGACTG -3'
Posted On 2021-01-18