Incidental Mutation 'R8490:Ptgfrn'
ID 657937
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8490 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101056370 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 642 (M642K)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect probably damaging
Transcript: ENSMUST00000102694
AA Change: M642K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: M642K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,284,097 K1609Q probably damaging Het
Arl5a A G 2: 52,424,602 F12L probably benign Het
Armc9 C T 1: 86,274,403 T761I probably benign Het
Bmp1 A G 14: 70,490,133 F670S possibly damaging Het
Cd34 T C 1: 194,938,973 V3A probably benign Het
Cdkn2a A T 4: 89,294,522 M1K probably null Het
Cep135 C A 5: 76,638,207 H1052Q probably benign Het
Cfap100 T C 6: 90,413,739 probably benign Het
Cib4 A T 5: 30,545,731 Y17N probably damaging Het
Col3a1 T G 1: 45,345,956 S78A probably benign Het
Crebzf A G 7: 90,443,498 M162V probably benign Het
Dbx2 T A 15: 95,654,573 M64L possibly damaging Het
Epb41l2 A T 10: 25,504,230 T884S probably damaging Het
Erich3 T A 3: 154,695,824 S37T Het
Eya1 G T 1: 14,184,675 Q383K possibly damaging Het
Gm15130 A T 2: 111,152,885 probably null Het
Ido1 A T 8: 24,596,938 M1K probably null Het
Loxhd1 C T 18: 77,441,466 T1069M possibly damaging Het
Lrrtm2 T G 18: 35,213,398 probably null Het
Map1a C T 2: 121,304,564 H1716Y possibly damaging Het
Mycbp2 T A 14: 103,208,831 T1854S probably benign Het
Myh13 T C 11: 67,364,525 S1574P probably damaging Het
Neu1 G A 17: 34,932,006 A78T probably benign Het
Nfam1 T C 15: 83,023,037 probably benign Het
Olfr1080 A T 2: 86,553,683 M147K probably benign Het
Olfr1257 A C 2: 89,881,167 T114P probably damaging Het
Olfr387-ps1 T A 11: 73,664,849 L80Q probably damaging Het
Pdgfra T C 5: 75,170,668 probably null Het
R3hdm1 T A 1: 128,235,127 H980Q probably benign Het
Rfc2 C A 5: 134,582,844 S19* probably null Het
Rhbdf1 C A 11: 32,210,162 S738I probably damaging Het
Rif1 T A 2: 52,110,999 N1488K probably damaging Het
Rnf31 G A 14: 55,596,109 V525I probably damaging Het
Rps27a T C 11: 29,546,719 D58G probably benign Het
Serpinc1 T G 1: 160,989,458 C41G probably damaging Het
Siglece A T 7: 43,660,062 V24D probably benign Het
Sparcl1 T A 5: 104,085,708 R592W probably null Het
Stard13 A G 5: 151,063,625 S104P probably damaging Het
Ston2 A G 12: 91,648,131 V501A possibly damaging Het
Sv2b C A 7: 75,206,085 probably null Het
Tiam1 T C 16: 89,885,044 R349G probably damaging Het
Tmprss11g A G 5: 86,492,117 probably null Het
Tnik G T 3: 28,596,172 R507L probably damaging Het
Trabd2b G T 4: 114,602,916 S417I probably damaging Het
Ube2q1 T A 3: 89,774,001 V97E probably benign Het
Vim A T 2: 13,579,454 N306Y probably damaging Het
Vmn1r216 G T 13: 23,099,809 A221S possibly damaging Het
Vmn2r113 G A 17: 22,958,398 A719T probably benign Het
Vmn2r66 A G 7: 85,005,586 probably null Het
Vps45 T C 3: 96,041,349 S365G probably benign Het
Zzz3 T A 3: 152,428,653 C449* probably null Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCACCCGGGCCAATCTATG -3'
(R):5'- GAGATGACTTGCAAAGTGTCTTC -3'

Sequencing Primer
(F):5'- GGGCCAATCTATGACTTCACAGAG -3'
(R):5'- ATTAAGTCGCCACGATACTCAGTTC -3'
Posted On 2021-01-18