Incidental Mutation 'R8490:Zzz3'
ID 657938
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8490 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 152428653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 449 (C449*)
Ref Sequence ENSEMBL: ENSMUSP00000101707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably null
Transcript: ENSMUST00000089982
AA Change: C449*
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: C449*

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106100
AA Change: C449*
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: C449*

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106101
AA Change: C449*
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: C449*

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106103
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200570
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,284,097 K1609Q probably damaging Het
Arl5a A G 2: 52,424,602 F12L probably benign Het
Armc9 C T 1: 86,274,403 T761I probably benign Het
Bmp1 A G 14: 70,490,133 F670S possibly damaging Het
Cd34 T C 1: 194,938,973 V3A probably benign Het
Cdkn2a A T 4: 89,294,522 M1K probably null Het
Cep135 C A 5: 76,638,207 H1052Q probably benign Het
Cfap100 T C 6: 90,413,739 probably benign Het
Cib4 A T 5: 30,545,731 Y17N probably damaging Het
Col3a1 T G 1: 45,345,956 S78A probably benign Het
Crebzf A G 7: 90,443,498 M162V probably benign Het
Dbx2 T A 15: 95,654,573 M64L possibly damaging Het
Epb41l2 A T 10: 25,504,230 T884S probably damaging Het
Erich3 T A 3: 154,695,824 S37T Het
Eya1 G T 1: 14,184,675 Q383K possibly damaging Het
Gm15130 A T 2: 111,152,885 probably null Het
Ido1 A T 8: 24,596,938 M1K probably null Het
Loxhd1 C T 18: 77,441,466 T1069M possibly damaging Het
Lrrtm2 T G 18: 35,213,398 probably null Het
Map1a C T 2: 121,304,564 H1716Y possibly damaging Het
Mycbp2 T A 14: 103,208,831 T1854S probably benign Het
Myh13 T C 11: 67,364,525 S1574P probably damaging Het
Neu1 G A 17: 34,932,006 A78T probably benign Het
Nfam1 T C 15: 83,023,037 probably benign Het
Olfr1080 A T 2: 86,553,683 M147K probably benign Het
Olfr1257 A C 2: 89,881,167 T114P probably damaging Het
Olfr387-ps1 T A 11: 73,664,849 L80Q probably damaging Het
Pdgfra T C 5: 75,170,668 probably null Het
Ptgfrn A T 3: 101,056,370 M642K probably damaging Het
R3hdm1 T A 1: 128,235,127 H980Q probably benign Het
Rfc2 C A 5: 134,582,844 S19* probably null Het
Rhbdf1 C A 11: 32,210,162 S738I probably damaging Het
Rif1 T A 2: 52,110,999 N1488K probably damaging Het
Rnf31 G A 14: 55,596,109 V525I probably damaging Het
Rps27a T C 11: 29,546,719 D58G probably benign Het
Serpinc1 T G 1: 160,989,458 C41G probably damaging Het
Siglece A T 7: 43,660,062 V24D probably benign Het
Sparcl1 T A 5: 104,085,708 R592W probably null Het
Stard13 A G 5: 151,063,625 S104P probably damaging Het
Ston2 A G 12: 91,648,131 V501A possibly damaging Het
Sv2b C A 7: 75,206,085 probably null Het
Tiam1 T C 16: 89,885,044 R349G probably damaging Het
Tmprss11g A G 5: 86,492,117 probably null Het
Tnik G T 3: 28,596,172 R507L probably damaging Het
Trabd2b G T 4: 114,602,916 S417I probably damaging Het
Ube2q1 T A 3: 89,774,001 V97E probably benign Het
Vim A T 2: 13,579,454 N306Y probably damaging Het
Vmn1r216 G T 13: 23,099,809 A221S possibly damaging Het
Vmn2r113 G A 17: 22,958,398 A719T probably benign Het
Vmn2r66 A G 7: 85,005,586 probably null Het
Vps45 T C 3: 96,041,349 S365G probably benign Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGAGAACTTCACCTCGGAG -3'
(R):5'- AAAGCAGAACGCATGGTTAC -3'

Sequencing Primer
(F):5'- TTCACCTCGGAGGGCGG -3'
(R):5'- TGGTTACCATGGTTACACATACTC -3'
Posted On 2021-01-18