Incidental Mutation 'R8490:Rhbdf1'
ID 657956
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Name rhomboid 5 homolog 1
Synonyms Dist, Dist1, Egfr-rs
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8490 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32209585-32222300 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32210162 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 738 (S738I)
Ref Sequence ENSEMBL: ENSMUSP00000020524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000146179] [ENSMUST00000149043] [ENSMUST00000150381]
AlphaFold Q6PIX5
Predicted Effect probably damaging
Transcript: ENSMUST00000020524
AA Change: S738I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: S738I

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143988
AA Change: S113I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282
AA Change: S113I

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,284,097 K1609Q probably damaging Het
Arl5a A G 2: 52,424,602 F12L probably benign Het
Armc9 C T 1: 86,274,403 T761I probably benign Het
Bmp1 A G 14: 70,490,133 F670S possibly damaging Het
Cd34 T C 1: 194,938,973 V3A probably benign Het
Cdkn2a A T 4: 89,294,522 M1K probably null Het
Cep135 C A 5: 76,638,207 H1052Q probably benign Het
Cfap100 T C 6: 90,413,739 probably benign Het
Cib4 A T 5: 30,545,731 Y17N probably damaging Het
Col3a1 T G 1: 45,345,956 S78A probably benign Het
Crebzf A G 7: 90,443,498 M162V probably benign Het
Dbx2 T A 15: 95,654,573 M64L possibly damaging Het
Epb41l2 A T 10: 25,504,230 T884S probably damaging Het
Erich3 T A 3: 154,695,824 S37T Het
Eya1 G T 1: 14,184,675 Q383K possibly damaging Het
Gm15130 A T 2: 111,152,885 probably null Het
Ido1 A T 8: 24,596,938 M1K probably null Het
Loxhd1 C T 18: 77,441,466 T1069M possibly damaging Het
Lrrtm2 T G 18: 35,213,398 probably null Het
Map1a C T 2: 121,304,564 H1716Y possibly damaging Het
Mycbp2 T A 14: 103,208,831 T1854S probably benign Het
Myh13 T C 11: 67,364,525 S1574P probably damaging Het
Neu1 G A 17: 34,932,006 A78T probably benign Het
Nfam1 T C 15: 83,023,037 probably benign Het
Olfr1080 A T 2: 86,553,683 M147K probably benign Het
Olfr1257 A C 2: 89,881,167 T114P probably damaging Het
Olfr387-ps1 T A 11: 73,664,849 L80Q probably damaging Het
Pdgfra T C 5: 75,170,668 probably null Het
Ptgfrn A T 3: 101,056,370 M642K probably damaging Het
R3hdm1 T A 1: 128,235,127 H980Q probably benign Het
Rfc2 C A 5: 134,582,844 S19* probably null Het
Rif1 T A 2: 52,110,999 N1488K probably damaging Het
Rnf31 G A 14: 55,596,109 V525I probably damaging Het
Rps27a T C 11: 29,546,719 D58G probably benign Het
Serpinc1 T G 1: 160,989,458 C41G probably damaging Het
Siglece A T 7: 43,660,062 V24D probably benign Het
Sparcl1 T A 5: 104,085,708 R592W probably null Het
Stard13 A G 5: 151,063,625 S104P probably damaging Het
Ston2 A G 12: 91,648,131 V501A possibly damaging Het
Sv2b C A 7: 75,206,085 probably null Het
Tiam1 T C 16: 89,885,044 R349G probably damaging Het
Tmprss11g A G 5: 86,492,117 probably null Het
Tnik G T 3: 28,596,172 R507L probably damaging Het
Trabd2b G T 4: 114,602,916 S417I probably damaging Het
Ube2q1 T A 3: 89,774,001 V97E probably benign Het
Vim A T 2: 13,579,454 N306Y probably damaging Het
Vmn1r216 G T 13: 23,099,809 A221S possibly damaging Het
Vmn2r113 G A 17: 22,958,398 A719T probably benign Het
Vmn2r66 A G 7: 85,005,586 probably null Het
Vps45 T C 3: 96,041,349 S365G probably benign Het
Zzz3 T A 3: 152,428,653 C449* probably null Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
R8939:Rhbdf1 UTSW 11 32210093 missense probably benign 0.00
R9040:Rhbdf1 UTSW 11 32213063 missense probably benign 0.23
R9257:Rhbdf1 UTSW 11 32210754 missense probably benign 0.00
R9509:Rhbdf1 UTSW 11 32215055 missense possibly damaging 0.96
R9575:Rhbdf1 UTSW 11 32213101 missense not run
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCGGTACAGGTCGAACTTG -3'
(R):5'- ACCCTCTATGTGTACCTGTGG -3'

Sequencing Primer
(F):5'- TCGAACTTGCCAAAGCTGATG -3'
(R):5'- TACCTGTGGCTAGCGTGAC -3'
Posted On 2021-01-18