Incidental Mutation 'R8490:Myh13'
ID657957
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R8490 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67364525 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1574 (S1574P)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably damaging
Transcript: ENSMUST00000081911
AA Change: S1574P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: S1574P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108684
AA Change: S1574P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: S1574P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180845
AA Change: S1574P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: S1574P

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181027
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,284,097 K1609Q probably damaging Het
Arl5a A G 2: 52,424,602 F12L probably benign Het
Armc9 C T 1: 86,274,403 T761I probably benign Het
Bmp1 A G 14: 70,490,133 F670S possibly damaging Het
Cd34 T C 1: 194,938,973 V3A probably benign Het
Cdkn2a A T 4: 89,294,522 M1K probably null Het
Cep135 C A 5: 76,638,207 H1052Q probably benign Het
Cfap100 T C 6: 90,413,739 probably benign Het
Cib4 A T 5: 30,545,731 Y17N probably damaging Het
Col3a1 T G 1: 45,345,956 S78A probably benign Het
Crebzf A G 7: 90,443,498 M162V probably benign Het
Dbx2 T A 15: 95,654,573 M64L possibly damaging Het
Epb41l2 A T 10: 25,504,230 T884S probably damaging Het
Erich3 T A 3: 154,695,824 S37T Het
Eya1 G T 1: 14,184,675 Q383K possibly damaging Het
Gm15130 A T 2: 111,152,885 probably null Het
Ido1 A T 8: 24,596,938 M1K probably null Het
Loxhd1 C T 18: 77,441,466 T1069M possibly damaging Het
Lrrtm2 T G 18: 35,213,398 probably null Het
Map1a C T 2: 121,304,564 H1716Y possibly damaging Het
Mycbp2 T A 14: 103,208,831 T1854S probably benign Het
Neu1 G A 17: 34,932,006 A78T probably benign Het
Nfam1 T C 15: 83,023,037 probably benign Het
Olfr1080 A T 2: 86,553,683 M147K probably benign Het
Olfr1257 A C 2: 89,881,167 T114P probably damaging Het
Olfr387-ps1 T A 11: 73,664,849 L80Q probably damaging Het
Pdgfra T C 5: 75,170,668 probably null Het
Ptgfrn A T 3: 101,056,370 M642K probably damaging Het
R3hdm1 T A 1: 128,235,127 H980Q probably benign Het
Rfc2 C A 5: 134,582,844 S19* probably null Het
Rhbdf1 C A 11: 32,210,162 S738I probably damaging Het
Rif1 T A 2: 52,110,999 N1488K probably damaging Het
Rnf31 G A 14: 55,596,109 V525I probably damaging Het
Rps27a T C 11: 29,546,719 D58G probably benign Het
Serpinc1 T G 1: 160,989,458 C41G probably damaging Het
Siglece A T 7: 43,660,062 V24D probably benign Het
Sparcl1 T A 5: 104,085,708 R592W probably null Het
Stard13 A G 5: 151,063,625 S104P probably damaging Het
Ston2 A G 12: 91,648,131 V501A possibly damaging Het
Sv2b C A 7: 75,206,085 probably null Het
Tiam1 T C 16: 89,885,044 R349G probably damaging Het
Tmprss11g A G 5: 86,492,117 probably null Het
Tnik G T 3: 28,596,172 R507L probably damaging Het
Trabd2b G T 4: 114,602,916 S417I probably damaging Het
Ube2q1 T A 3: 89,774,001 V97E probably benign Het
Vim A T 2: 13,579,454 N306Y probably damaging Het
Vmn1r216 G T 13: 23,099,809 A221S possibly damaging Het
Vmn2r113 G A 17: 22,958,398 A719T probably benign Het
Vmn2r66 A G 7: 85,005,586 probably null Het
Vps45 T C 3: 96,041,349 S365G probably benign Het
Zzz3 T A 3: 152,428,653 C449* probably null Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTTGAAAGAGAATGCTCACTGAAGG -3'
(R):5'- CATGGCTCAGCTGAATCTCC -3'

Sequencing Primer
(F):5'- TGCCTGCTCAGTCAAAGAG -3'
(R):5'- AGCTGAATCTCCATCTCGTTGAG -3'
Posted On2021-01-18