Incidental Mutation 'R8490:Bmp1'
ID 657962
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8490 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70727573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 670 (F670S)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect possibly damaging
Transcript: ENSMUST00000022693
AA Change: F670S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: F670S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,323,256 (GRCm39) K1609Q probably damaging Het
Arl5a A G 2: 52,314,614 (GRCm39) F12L probably benign Het
Armc9 C T 1: 86,202,125 (GRCm39) T761I probably benign Het
Cd34 T C 1: 194,621,281 (GRCm39) V3A probably benign Het
Cdkn2a A T 4: 89,212,759 (GRCm39) M1K probably null Het
Cep135 C A 5: 76,786,054 (GRCm39) H1052Q probably benign Het
Cfap100 T C 6: 90,390,721 (GRCm39) probably benign Het
Cib4 A T 5: 30,703,075 (GRCm39) Y17N probably damaging Het
Col3a1 T G 1: 45,385,116 (GRCm39) S78A probably benign Het
Crebzf A G 7: 90,092,706 (GRCm39) M162V probably benign Het
Dbx2 T A 15: 95,552,454 (GRCm39) M64L possibly damaging Het
Epb41l2 A T 10: 25,380,128 (GRCm39) T884S probably damaging Het
Erich3 T A 3: 154,401,461 (GRCm39) S37T Het
Eya1 G T 1: 14,254,899 (GRCm39) Q383K possibly damaging Het
Gm15130 A T 2: 110,983,230 (GRCm39) probably null Het
Ido1 A T 8: 25,086,954 (GRCm39) M1K probably null Het
Loxhd1 C T 18: 77,529,162 (GRCm39) T1069M possibly damaging Het
Lrrtm2 T G 18: 35,346,451 (GRCm39) probably null Het
Map1a C T 2: 121,135,045 (GRCm39) H1716Y possibly damaging Het
Mycbp2 T A 14: 103,446,267 (GRCm39) T1854S probably benign Het
Myh13 T C 11: 67,255,351 (GRCm39) S1574P probably damaging Het
Neu1 G A 17: 35,150,982 (GRCm39) A78T probably benign Het
Nfam1 T C 15: 82,907,238 (GRCm39) probably benign Het
Or1e27-ps1 T A 11: 73,555,675 (GRCm39) L80Q probably damaging Het
Or4c10b A C 2: 89,711,511 (GRCm39) T114P probably damaging Het
Or8k33 A T 2: 86,384,027 (GRCm39) M147K probably benign Het
Pdgfra T C 5: 75,331,329 (GRCm39) probably null Het
Ptgfrn A T 3: 100,963,686 (GRCm39) M642K probably damaging Het
R3hdm1 T A 1: 128,162,864 (GRCm39) H980Q probably benign Het
Rfc2 C A 5: 134,611,698 (GRCm39) S19* probably null Het
Rhbdf1 C A 11: 32,160,162 (GRCm39) S738I probably damaging Het
Rif1 T A 2: 52,001,011 (GRCm39) N1488K probably damaging Het
Rnf31 G A 14: 55,833,566 (GRCm39) V525I probably damaging Het
Rps27a T C 11: 29,496,719 (GRCm39) D58G probably benign Het
Serpinc1 T G 1: 160,817,028 (GRCm39) C41G probably damaging Het
Siglece A T 7: 43,309,486 (GRCm39) V24D probably benign Het
Sparcl1 T A 5: 104,233,574 (GRCm39) R592W probably null Het
Stard13 A G 5: 150,987,090 (GRCm39) S104P probably damaging Het
Ston2 A G 12: 91,614,905 (GRCm39) V501A possibly damaging Het
Sv2b C A 7: 74,855,833 (GRCm39) probably null Het
Tiam1 T C 16: 89,681,932 (GRCm39) R349G probably damaging Het
Tmprss11g A G 5: 86,639,976 (GRCm39) probably null Het
Tnik G T 3: 28,650,321 (GRCm39) R507L probably damaging Het
Trabd2b G T 4: 114,460,113 (GRCm39) S417I probably damaging Het
Ube2q1 T A 3: 89,681,308 (GRCm39) V97E probably benign Het
Vim A T 2: 13,584,265 (GRCm39) N306Y probably damaging Het
Vmn1r216 G T 13: 23,283,979 (GRCm39) A221S possibly damaging Het
Vmn2r113 G A 17: 23,177,372 (GRCm39) A719T probably benign Het
Vmn2r66 A G 7: 84,654,794 (GRCm39) probably null Het
Vps45 T C 3: 95,948,661 (GRCm39) S365G probably benign Het
Zzz3 T A 3: 152,134,290 (GRCm39) C449* probably null Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATTCAGATGCCCCAGGG -3'
(R):5'- ACACAGCAGCGTTTTGTTG -3'

Sequencing Primer
(F):5'- CTGTACTGATGGAGGATAATAAGTTG -3'
(R):5'- TTGGGGAGCGCAGATGC -3'
Posted On 2021-01-18