Incidental Mutation 'R8490:Bmp1'
ID 657962
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8490 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70474558-70520234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70490133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 670 (F670S)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect possibly damaging
Transcript: ENSMUST00000022693
AA Change: F670S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: F670S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,284,097 K1609Q probably damaging Het
Arl5a A G 2: 52,424,602 F12L probably benign Het
Armc9 C T 1: 86,274,403 T761I probably benign Het
Cd34 T C 1: 194,938,973 V3A probably benign Het
Cdkn2a A T 4: 89,294,522 M1K probably null Het
Cep135 C A 5: 76,638,207 H1052Q probably benign Het
Cfap100 T C 6: 90,413,739 probably benign Het
Cib4 A T 5: 30,545,731 Y17N probably damaging Het
Col3a1 T G 1: 45,345,956 S78A probably benign Het
Crebzf A G 7: 90,443,498 M162V probably benign Het
Dbx2 T A 15: 95,654,573 M64L possibly damaging Het
Epb41l2 A T 10: 25,504,230 T884S probably damaging Het
Erich3 T A 3: 154,695,824 S37T Het
Eya1 G T 1: 14,184,675 Q383K possibly damaging Het
Gm15130 A T 2: 111,152,885 probably null Het
Ido1 A T 8: 24,596,938 M1K probably null Het
Loxhd1 C T 18: 77,441,466 T1069M possibly damaging Het
Lrrtm2 T G 18: 35,213,398 probably null Het
Map1a C T 2: 121,304,564 H1716Y possibly damaging Het
Mycbp2 T A 14: 103,208,831 T1854S probably benign Het
Myh13 T C 11: 67,364,525 S1574P probably damaging Het
Neu1 G A 17: 34,932,006 A78T probably benign Het
Nfam1 T C 15: 83,023,037 probably benign Het
Olfr1080 A T 2: 86,553,683 M147K probably benign Het
Olfr1257 A C 2: 89,881,167 T114P probably damaging Het
Olfr387-ps1 T A 11: 73,664,849 L80Q probably damaging Het
Pdgfra T C 5: 75,170,668 probably null Het
Ptgfrn A T 3: 101,056,370 M642K probably damaging Het
R3hdm1 T A 1: 128,235,127 H980Q probably benign Het
Rfc2 C A 5: 134,582,844 S19* probably null Het
Rhbdf1 C A 11: 32,210,162 S738I probably damaging Het
Rif1 T A 2: 52,110,999 N1488K probably damaging Het
Rnf31 G A 14: 55,596,109 V525I probably damaging Het
Rps27a T C 11: 29,546,719 D58G probably benign Het
Serpinc1 T G 1: 160,989,458 C41G probably damaging Het
Siglece A T 7: 43,660,062 V24D probably benign Het
Sparcl1 T A 5: 104,085,708 R592W probably null Het
Stard13 A G 5: 151,063,625 S104P probably damaging Het
Ston2 A G 12: 91,648,131 V501A possibly damaging Het
Sv2b C A 7: 75,206,085 probably null Het
Tiam1 T C 16: 89,885,044 R349G probably damaging Het
Tmprss11g A G 5: 86,492,117 probably null Het
Tnik G T 3: 28,596,172 R507L probably damaging Het
Trabd2b G T 4: 114,602,916 S417I probably damaging Het
Ube2q1 T A 3: 89,774,001 V97E probably benign Het
Vim A T 2: 13,579,454 N306Y probably damaging Het
Vmn1r216 G T 13: 23,099,809 A221S possibly damaging Het
Vmn2r113 G A 17: 22,958,398 A719T probably benign Het
Vmn2r66 A G 7: 85,005,586 probably null Het
Vps45 T C 3: 96,041,349 S365G probably benign Het
Zzz3 T A 3: 152,428,653 C449* probably null Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70490122 missense probably benign 0.44
R7716:Bmp1 UTSW 14 70477922 nonsense probably null
R7749:Bmp1 UTSW 14 70492844 missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70492084 missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70508565 missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70519889 missense probably damaging 0.97
R8827:Bmp1 UTSW 14 70490642 missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70490190 missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70490173 missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70519898 missense probably benign
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATTCAGATGCCCCAGGG -3'
(R):5'- ACACAGCAGCGTTTTGTTG -3'

Sequencing Primer
(F):5'- CTGTACTGATGGAGGATAATAAGTTG -3'
(R):5'- TTGGGGAGCGCAGATGC -3'
Posted On 2021-01-18