Incidental Mutation 'R8491:Washc4'
ID658002
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8491 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83576123 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 706 (D706G)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably benign
Transcript: ENSMUST00000038388
AA Change: D706G

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: D706G

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 52,040,312 I44F unknown Het
Agap1 A G 1: 89,609,572 E100G probably damaging Het
Aoc3 G T 11: 101,332,216 R426L probably benign Het
Aspm T G 1: 139,457,695 L359R probably damaging Het
Atp8b2 A G 3: 89,958,369 S75P probably damaging Het
Bcl9l A G 9: 44,500,768 E17G probably benign Het
Casc3 G T 11: 98,823,151 R403L probably benign Het
Cdh16 T C 8: 104,617,049 D605G probably damaging Het
Cdh2 A G 18: 16,624,718 probably null Het
Cers5 T A 15: 99,740,950 K161N probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap3 A T 13: 64,785,343 D454E probably damaging Het
Cxcl15 T A 5: 90,795,230 C30* probably null Het
Cyp4a12a C A 4: 115,301,453 probably null Het
Dlc1 A T 8: 36,584,846 I577N probably benign Het
Dusp6 C A 10: 99,266,219 R210S possibly damaging Het
Faxc T A 4: 21,993,319 M321K probably damaging Het
Fez2 C A 17: 78,384,771 V340L probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gdnf A G 15: 7,834,791 I228V possibly damaging Het
Gm12258 A G 11: 58,854,296 T18A Het
Gm5460 T C 14: 34,039,783 L194P probably damaging Het
Gm6040 T G 8: 20,917,119 R28S possibly damaging Het
Gmps A G 3: 64,014,358 E594G probably benign Het
Hspg2 T C 4: 137,553,719 V3334A probably benign Het
Idh3a T C 9: 54,599,679 probably null Het
Ins1 A G 19: 52,264,370 probably benign Het
Mug1 A T 6: 121,882,729 D1229V probably damaging Het
Ndufs1 T C 1: 63,157,225 D347G probably damaging Het
Olfr1061 A G 2: 86,413,755 I99T probably benign Het
Olfr653 G A 7: 104,580,035 V130I probably damaging Het
Pclo C A 5: 14,515,230 N3K unknown Het
Pigl A G 11: 62,473,467 R112G probably null Het
Prkcq T C 2: 11,279,524 Y502H probably damaging Het
Psg16 T C 7: 17,090,512 Y74H probably damaging Het
Psme4 G A 11: 30,772,161 G60D possibly damaging Het
Rpp14 A T 14: 8,083,925 Q27L possibly damaging Het
Serpini2 A C 3: 75,252,515 C315G probably damaging Het
Slitrk3 A G 3: 73,051,259 I60T possibly damaging Het
Svil T C 18: 5,106,678 Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tob1 A G 11: 94,214,289 D217G probably benign Het
Trim21 A C 7: 102,559,482 D343E probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trmt13 T C 3: 116,582,579 R388G probably benign Het
Ubqlnl A G 7: 104,149,375 V305A probably benign Het
Ushbp1 A G 8: 71,392,397 V244A probably benign Het
Vdac2 T A 14: 21,837,770 N60K possibly damaging Het
Vwa5a A G 9: 38,741,180 E753G probably damaging Het
Zbtb5 T C 4: 44,995,090 D98G probably damaging Het
Zfp53 A G 17: 21,509,359 I551M probably benign Het
Zfp958 G T 8: 4,626,215 R61I probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7900:Washc4 UTSW 10 83573773 splice site probably null
R8791:Washc4 UTSW 10 83550884 missense probably benign 0.08
R8804:Washc4 UTSW 10 83572151 missense probably damaging 0.99
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATGCGCGTGTAGGAGTGATC -3'
(R):5'- ACCCCACAAATTGCTATGCTTG -3'

Sequencing Primer
(F):5'- TGATCTGCAGTGGGAGCCATC -3'
(R):5'- TGTATCAACACTCAGTGGGC -3'
Posted On2021-01-18