Incidental Mutation 'R8491:Psme4'
ID658004
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8491 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30772161 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 60 (G60D)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041231
AA Change: G60D

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: G60D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154757
SMART Domains Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 52,040,312 I44F unknown Het
Agap1 A G 1: 89,609,572 E100G probably damaging Het
Aoc3 G T 11: 101,332,216 R426L probably benign Het
Aspm T G 1: 139,457,695 L359R probably damaging Het
Atp8b2 A G 3: 89,958,369 S75P probably damaging Het
Bcl9l A G 9: 44,500,768 E17G probably benign Het
Casc3 G T 11: 98,823,151 R403L probably benign Het
Cdh16 T C 8: 104,617,049 D605G probably damaging Het
Cdh2 A G 18: 16,624,718 probably null Het
Cers5 T A 15: 99,740,950 K161N probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap3 A T 13: 64,785,343 D454E probably damaging Het
Cxcl15 T A 5: 90,795,230 C30* probably null Het
Cyp4a12a C A 4: 115,301,453 probably null Het
Dlc1 A T 8: 36,584,846 I577N probably benign Het
Dusp6 C A 10: 99,266,219 R210S possibly damaging Het
Faxc T A 4: 21,993,319 M321K probably damaging Het
Fez2 C A 17: 78,384,771 V340L probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gdnf A G 15: 7,834,791 I228V possibly damaging Het
Gm12258 A G 11: 58,854,296 T18A Het
Gm5460 T C 14: 34,039,783 L194P probably damaging Het
Gm6040 T G 8: 20,917,119 R28S possibly damaging Het
Gmps A G 3: 64,014,358 E594G probably benign Het
Hspg2 T C 4: 137,553,719 V3334A probably benign Het
Idh3a T C 9: 54,599,679 probably null Het
Ins1 A G 19: 52,264,370 probably benign Het
Mug1 A T 6: 121,882,729 D1229V probably damaging Het
Ndufs1 T C 1: 63,157,225 D347G probably damaging Het
Olfr1061 A G 2: 86,413,755 I99T probably benign Het
Olfr653 G A 7: 104,580,035 V130I probably damaging Het
Pclo C A 5: 14,515,230 N3K unknown Het
Pigl A G 11: 62,473,467 R112G probably null Het
Prkcq T C 2: 11,279,524 Y502H probably damaging Het
Psg16 T C 7: 17,090,512 Y74H probably damaging Het
Rpp14 A T 14: 8,083,925 Q27L possibly damaging Het
Serpini2 A C 3: 75,252,515 C315G probably damaging Het
Slitrk3 A G 3: 73,051,259 I60T possibly damaging Het
Svil T C 18: 5,106,678 Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tob1 A G 11: 94,214,289 D217G probably benign Het
Trim21 A C 7: 102,559,482 D343E probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trmt13 T C 3: 116,582,579 R388G probably benign Het
Ubqlnl A G 7: 104,149,375 V305A probably benign Het
Ushbp1 A G 8: 71,392,397 V244A probably benign Het
Vdac2 T A 14: 21,837,770 N60K possibly damaging Het
Vwa5a A G 9: 38,741,180 E753G probably damaging Het
Washc4 A G 10: 83,576,123 D706G probably benign Het
Zbtb5 T C 4: 44,995,090 D98G probably damaging Het
Zfp53 A G 17: 21,509,359 I551M probably benign Het
Zfp958 G T 8: 4,626,215 R61I probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGCCAGGTTACCTCC -3'
(R):5'- AAGGACCAGAACGCTGATC -3'

Sequencing Primer
(F):5'- AAGTGACTTGAGGCCGGTC -3'
(R):5'- GTCCCACGGAAAGCAACGAG -3'
Posted On2021-01-18