Mutagenetix > Incidental Mutation

Incidental Mutation 'R8491:Psme4'

658004

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

067933-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8491 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30772161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 60 (G60D)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041231
AA Change: G60D

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: G60D

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154757

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aard	A	T	15: 52,040,312	I44F	unknown	Het
Agap1	A	G	1: 89,609,572	E100G	probably damaging	Het
Aoc3	G	T	11: 101,332,216	R426L	probably benign	Het
Aspm	T	G	1: 139,457,695	L359R	probably damaging	Het
Atp8b2	A	G	3: 89,958,369	S75P	probably damaging	Het
Bcl9l	A	G	9: 44,500,768	E17G	probably benign	Het
Casc3	G	T	11: 98,823,151	R403L	probably benign	Het
Cdh16	T	C	8: 104,617,049	D605G	probably damaging	Het
Cdh2	A	G	18: 16,624,718		probably null	Het
Cers5	T	A	15: 99,740,950	K161N	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cntnap3	A	T	13: 64,785,343	D454E	probably damaging	Het
Cxcl15	T	A	5: 90,795,230	C30*	probably null	Het
Cyp4a12a	C	A	4: 115,301,453		probably null	Het
Dlc1	A	T	8: 36,584,846	I577N	probably benign	Het
Dusp6	C	A	10: 99,266,219	R210S	possibly damaging	Het
Faxc	T	A	4: 21,993,319	M321K	probably damaging	Het
Fez2	C	A	17: 78,384,771	V340L	probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gdnf	A	G	15: 7,834,791	I228V	possibly damaging	Het
Gm12258	A	G	11: 58,854,296	T18A		Het
Gm5460	T	C	14: 34,039,783	L194P	probably damaging	Het
Gm6040	T	G	8: 20,917,119	R28S	possibly damaging	Het
Gmps	A	G	3: 64,014,358	E594G	probably benign	Het
Hspg2	T	C	4: 137,553,719	V3334A	probably benign	Het
Idh3a	T	C	9: 54,599,679		probably null	Het
Ins1	A	G	19: 52,264,370		probably benign	Het
Mug1	A	T	6: 121,882,729	D1229V	probably damaging	Het
Ndufs1	T	C	1: 63,157,225	D347G	probably damaging	Het
Olfr1061	A	G	2: 86,413,755	I99T	probably benign	Het
Olfr653	G	A	7: 104,580,035	V130I	probably damaging	Het
Pclo	C	A	5: 14,515,230	N3K	unknown	Het
Pigl	A	G	11: 62,473,467	R112G	probably null	Het
Prkcq	T	C	2: 11,279,524	Y502H	probably damaging	Het
Psg16	T	C	7: 17,090,512	Y74H	probably damaging	Het
Rpp14	A	T	14: 8,083,925	Q27L	possibly damaging	Het
Serpini2	A	C	3: 75,252,515	C315G	probably damaging	Het
Slitrk3	A	G	3: 73,051,259	I60T	possibly damaging	Het
Svil	T	C	18: 5,106,678	Y1436H	probably damaging	Het
Tmem245	T	C	4: 56,906,261	Q548R	probably benign	Het
Tob1	A	G	11: 94,214,289	D217G	probably benign	Het
Trim21	A	C	7: 102,559,482	D343E	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trmt13	T	C	3: 116,582,579	R388G	probably benign	Het
Ubqlnl	A	G	7: 104,149,375	V305A	probably benign	Het
Ushbp1	A	G	8: 71,392,397	V244A	probably benign	Het
Vdac2	T	A	14: 21,837,770	N60K	possibly damaging	Het
Vwa5a	A	G	9: 38,741,180	E753G	probably damaging	Het
Washc4	A	G	10: 83,576,123	D706G	probably benign	Het
Zbtb5	T	C	4: 44,995,090	D98G	probably damaging	Het
Zfp53	A	G	17: 21,509,359	I551M	probably benign	Het
Zfp958	G	T	8: 4,626,215	R61I	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGCAGCCAGGTTACCTCC -3'
(R):5'- AAGGACCAGAACGCTGATC -3'

Sequencing Primer
(F):5'- AAGTGACTTGAGGCCGGTC -3'
(R):5'- GTCCCACGGAAAGCAACGAG -3'

Posted On

2021-01-18