Incidental Mutation 'R8491:Tob1'
ID 658007
Institutional Source Beutler Lab
Gene Symbol Tob1
Ensembl Gene ENSMUSG00000037573
Gene Name transducer of ErbB-2.1
Synonyms Trob, Tob
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8491 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 94211454-94215495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94214289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 217 (D217G)
Ref Sequence ENSEMBL: ENSMUSP00000036039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041589]
AlphaFold Q61471
Predicted Effect probably benign
Transcript: ENSMUST00000041589
AA Change: D217G

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036039
Gene: ENSMUSG00000037573
AA Change: D217G

DomainStartEndE-ValueType
btg1 1 106 2.41e-77 SMART
low complexity region 141 160 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
low complexity region 238 280 N/A INTRINSIC
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and exhibit increased bone mass due to increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 52,040,312 I44F unknown Het
Agap1 A G 1: 89,609,572 E100G probably damaging Het
Aoc3 G T 11: 101,332,216 R426L probably benign Het
Aspm T G 1: 139,457,695 L359R probably damaging Het
Atp8b2 A G 3: 89,958,369 S75P probably damaging Het
Bcl9l A G 9: 44,500,768 E17G probably benign Het
Casc3 G T 11: 98,823,151 R403L probably benign Het
Cdh16 T C 8: 104,617,049 D605G probably damaging Het
Cdh2 A G 18: 16,624,718 probably null Het
Cers5 T A 15: 99,740,950 K161N probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap3 A T 13: 64,785,343 D454E probably damaging Het
Cxcl15 T A 5: 90,795,230 C30* probably null Het
Cyp4a12a C A 4: 115,301,453 probably null Het
Dlc1 A T 8: 36,584,846 I577N probably benign Het
Dusp6 C A 10: 99,266,219 R210S possibly damaging Het
Faxc T A 4: 21,993,319 M321K probably damaging Het
Fez2 C A 17: 78,384,771 V340L probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gdnf A G 15: 7,834,791 I228V possibly damaging Het
Gm12258 A G 11: 58,854,296 T18A Het
Gm5460 T C 14: 34,039,783 L194P probably damaging Het
Gm6040 T G 8: 20,917,119 R28S possibly damaging Het
Gmps A G 3: 64,014,358 E594G probably benign Het
Hspg2 T C 4: 137,553,719 V3334A probably benign Het
Idh3a T C 9: 54,599,679 probably null Het
Ins1 A G 19: 52,264,370 probably benign Het
Mug1 A T 6: 121,882,729 D1229V probably damaging Het
Ndufs1 T C 1: 63,157,225 D347G probably damaging Het
Olfr1061 A G 2: 86,413,755 I99T probably benign Het
Olfr653 G A 7: 104,580,035 V130I probably damaging Het
Pclo C A 5: 14,515,230 N3K unknown Het
Pigl A G 11: 62,473,467 R112G probably null Het
Prkcq T C 2: 11,279,524 Y502H probably damaging Het
Psg16 T C 7: 17,090,512 Y74H probably damaging Het
Psme4 G A 11: 30,772,161 G60D possibly damaging Het
Rpp14 A T 14: 8,083,925 Q27L possibly damaging Het
Serpini2 A C 3: 75,252,515 C315G probably damaging Het
Slitrk3 A G 3: 73,051,259 I60T possibly damaging Het
Svil T C 18: 5,106,678 Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Trim21 A C 7: 102,559,482 D343E probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trmt13 T C 3: 116,582,579 R388G probably benign Het
Ubqlnl A G 7: 104,149,375 V305A probably benign Het
Ushbp1 A G 8: 71,392,397 V244A probably benign Het
Vdac2 T A 14: 21,837,770 N60K possibly damaging Het
Vwa5a A G 9: 38,741,180 E753G probably damaging Het
Washc4 A G 10: 83,576,123 D706G probably benign Het
Zbtb5 T C 4: 44,995,090 D98G probably damaging Het
Zfp53 A G 17: 21,509,359 I551M probably benign Het
Zfp958 G T 8: 4,626,215 R61I probably damaging Het
Other mutations in Tob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Tob1 APN 11 94214055 missense probably damaging 1.00
IGL02028:Tob1 APN 11 94214226 missense probably benign 0.43
IGL02866:Tob1 APN 11 94214057 missense possibly damaging 0.87
FR4304:Tob1 UTSW 11 94214464 small insertion probably benign
FR4304:Tob1 UTSW 11 94214477 nonsense probably null
FR4340:Tob1 UTSW 11 94214454 small insertion probably benign
FR4340:Tob1 UTSW 11 94214460 small insertion probably benign
FR4340:Tob1 UTSW 11 94214477 small insertion probably benign
FR4342:Tob1 UTSW 11 94214472 small insertion probably benign
FR4449:Tob1 UTSW 11 94214468 small insertion probably benign
FR4449:Tob1 UTSW 11 94214475 small insertion probably benign
FR4548:Tob1 UTSW 11 94214455 small insertion probably benign
FR4548:Tob1 UTSW 11 94214469 small insertion probably benign
FR4589:Tob1 UTSW 11 94214451 small insertion probably benign
FR4589:Tob1 UTSW 11 94214477 frame shift probably null
FR4737:Tob1 UTSW 11 94214451 small insertion probably benign
FR4737:Tob1 UTSW 11 94214464 small insertion probably benign
FR4737:Tob1 UTSW 11 94214478 small insertion probably benign
FR4976:Tob1 UTSW 11 94214472 small insertion probably benign
R0142:Tob1 UTSW 11 94214597 missense probably damaging 1.00
R1777:Tob1 UTSW 11 94213754 missense probably damaging 1.00
R4213:Tob1 UTSW 11 94214192 missense probably damaging 1.00
R4280:Tob1 UTSW 11 94214322 missense probably benign
R4537:Tob1 UTSW 11 94214452 small deletion probably benign
R4899:Tob1 UTSW 11 94214452 small deletion probably benign
R5074:Tob1 UTSW 11 94213741 missense possibly damaging 0.88
R5502:Tob1 UTSW 11 94214452 small deletion probably benign
R5828:Tob1 UTSW 11 94213757 missense probably damaging 1.00
R5828:Tob1 UTSW 11 94213759 nonsense probably null
R7471:Tob1 UTSW 11 94213882 missense probably benign 0.45
R7839:Tob1 UTSW 11 94213772 missense probably damaging 1.00
R8383:Tob1 UTSW 11 94214377 small deletion probably benign
R9131:Tob1 UTSW 11 94214377 small deletion probably benign
RF028:Tob1 UTSW 11 94214451 small insertion probably benign
RF041:Tob1 UTSW 11 94214451 small insertion probably benign
RF042:Tob1 UTSW 11 94214451 small insertion probably benign
RF044:Tob1 UTSW 11 94214461 small insertion probably benign
RF054:Tob1 UTSW 11 94214461 small insertion probably benign
Z1177:Tob1 UTSW 11 94213992 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGTTCATGCCCATAAGCGAC -3'
(R):5'- TCCTTGGCATTGGGAGAAAGAG -3'

Sequencing Primer
(F):5'- ATAAGCGACCCGGCCTC -3'
(R):5'- CAGAGGTTTGCTGCTGCTGC -3'
Posted On 2021-01-18