Mutagenetix > Incidental Mutation

Incidental Mutation 'R8491:Tob1'

658007

Institutional Source

Beutler Lab

Gene Symbol

Tob1

Ensembl Gene

ENSMUSG00000037573

Gene Name

transducer of ErbB-2.1

Synonyms

Trob, Tob

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8491 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94211454-94215495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94214289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 217 (D217G)

Ref Sequence

ENSEMBL: ENSMUSP00000036039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041589]

AlphaFold

Q61471

Predicted Effect

probably benign
Transcript: ENSMUST00000041589
AA Change: D217G

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000036039
Gene: ENSMUSG00000037573
AA Change: D217G

Domain	Start	End	E-Value	Type
btg1	1	106	2.41e-77	SMART
low complexity region	141	160	N/A	INTRINSIC
low complexity region	176	187	N/A	INTRINSIC
low complexity region	238	280	N/A	INTRINSIC

Meta Mutation Damage Score

0.0579

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and exhibit increased bone mass due to increased osteoblast proliferation and differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aard	A	T	15: 52,040,312	I44F	unknown	Het
Agap1	A	G	1: 89,609,572	E100G	probably damaging	Het
Aoc3	G	T	11: 101,332,216	R426L	probably benign	Het
Aspm	T	G	1: 139,457,695	L359R	probably damaging	Het
Atp8b2	A	G	3: 89,958,369	S75P	probably damaging	Het
Bcl9l	A	G	9: 44,500,768	E17G	probably benign	Het
Casc3	G	T	11: 98,823,151	R403L	probably benign	Het
Cdh16	T	C	8: 104,617,049	D605G	probably damaging	Het
Cdh2	A	G	18: 16,624,718		probably null	Het
Cers5	T	A	15: 99,740,950	K161N	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cntnap3	A	T	13: 64,785,343	D454E	probably damaging	Het
Cxcl15	T	A	5: 90,795,230	C30*	probably null	Het
Cyp4a12a	C	A	4: 115,301,453		probably null	Het
Dlc1	A	T	8: 36,584,846	I577N	probably benign	Het
Dusp6	C	A	10: 99,266,219	R210S	possibly damaging	Het
Faxc	T	A	4: 21,993,319	M321K	probably damaging	Het
Fez2	C	A	17: 78,384,771	V340L	probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gdnf	A	G	15: 7,834,791	I228V	possibly damaging	Het
Gm12258	A	G	11: 58,854,296	T18A		Het
Gm5460	T	C	14: 34,039,783	L194P	probably damaging	Het
Gm6040	T	G	8: 20,917,119	R28S	possibly damaging	Het
Gmps	A	G	3: 64,014,358	E594G	probably benign	Het
Hspg2	T	C	4: 137,553,719	V3334A	probably benign	Het
Idh3a	T	C	9: 54,599,679		probably null	Het
Ins1	A	G	19: 52,264,370		probably benign	Het
Mug1	A	T	6: 121,882,729	D1229V	probably damaging	Het
Ndufs1	T	C	1: 63,157,225	D347G	probably damaging	Het
Olfr1061	A	G	2: 86,413,755	I99T	probably benign	Het
Olfr653	G	A	7: 104,580,035	V130I	probably damaging	Het
Pclo	C	A	5: 14,515,230	N3K	unknown	Het
Pigl	A	G	11: 62,473,467	R112G	probably null	Het
Prkcq	T	C	2: 11,279,524	Y502H	probably damaging	Het
Psg16	T	C	7: 17,090,512	Y74H	probably damaging	Het
Psme4	G	A	11: 30,772,161	G60D	possibly damaging	Het
Rpp14	A	T	14: 8,083,925	Q27L	possibly damaging	Het
Serpini2	A	C	3: 75,252,515	C315G	probably damaging	Het
Slitrk3	A	G	3: 73,051,259	I60T	possibly damaging	Het
Svil	T	C	18: 5,106,678	Y1436H	probably damaging	Het
Tmem245	T	C	4: 56,906,261	Q548R	probably benign	Het
Trim21	A	C	7: 102,559,482	D343E	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trmt13	T	C	3: 116,582,579	R388G	probably benign	Het
Ubqlnl	A	G	7: 104,149,375	V305A	probably benign	Het
Ushbp1	A	G	8: 71,392,397	V244A	probably benign	Het
Vdac2	T	A	14: 21,837,770	N60K	possibly damaging	Het
Vwa5a	A	G	9: 38,741,180	E753G	probably damaging	Het
Washc4	A	G	10: 83,576,123	D706G	probably benign	Het
Zbtb5	T	C	4: 44,995,090	D98G	probably damaging	Het
Zfp53	A	G	17: 21,509,359	I551M	probably benign	Het
Zfp958	G	T	8: 4,626,215	R61I	probably damaging	Het

Other mutations in Tob1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Tob1	APN	11	94214055	missense	probably damaging	1.00
IGL02028:Tob1	APN	11	94214226	missense	probably benign	0.43
IGL02866:Tob1	APN	11	94214057	missense	possibly damaging	0.87
FR4304:Tob1	UTSW	11	94214464	small insertion	probably benign
FR4304:Tob1	UTSW	11	94214477	nonsense	probably null
FR4340:Tob1	UTSW	11	94214454	small insertion	probably benign
FR4340:Tob1	UTSW	11	94214460	small insertion	probably benign
FR4340:Tob1	UTSW	11	94214477	small insertion	probably benign
FR4342:Tob1	UTSW	11	94214472	small insertion	probably benign
FR4449:Tob1	UTSW	11	94214468	small insertion	probably benign
FR4449:Tob1	UTSW	11	94214475	small insertion	probably benign
FR4548:Tob1	UTSW	11	94214455	small insertion	probably benign
FR4548:Tob1	UTSW	11	94214469	small insertion	probably benign
FR4589:Tob1	UTSW	11	94214451	small insertion	probably benign
FR4589:Tob1	UTSW	11	94214477	frame shift	probably null
FR4737:Tob1	UTSW	11	94214451	small insertion	probably benign
FR4737:Tob1	UTSW	11	94214464	small insertion	probably benign
FR4737:Tob1	UTSW	11	94214478	small insertion	probably benign
FR4976:Tob1	UTSW	11	94214472	small insertion	probably benign
R0142:Tob1	UTSW	11	94214597	missense	probably damaging	1.00
R1777:Tob1	UTSW	11	94213754	missense	probably damaging	1.00
R4213:Tob1	UTSW	11	94214192	missense	probably damaging	1.00
R4280:Tob1	UTSW	11	94214322	missense	probably benign
R4537:Tob1	UTSW	11	94214452	small deletion	probably benign
R4899:Tob1	UTSW	11	94214452	small deletion	probably benign
R5074:Tob1	UTSW	11	94213741	missense	possibly damaging	0.88
R5502:Tob1	UTSW	11	94214452	small deletion	probably benign
R5828:Tob1	UTSW	11	94213757	missense	probably damaging	1.00
R5828:Tob1	UTSW	11	94213759	nonsense	probably null
R7471:Tob1	UTSW	11	94213882	missense	probably benign	0.45
R7839:Tob1	UTSW	11	94213772	missense	probably damaging	1.00
R8383:Tob1	UTSW	11	94214377	small deletion	probably benign
R9131:Tob1	UTSW	11	94214377	small deletion	probably benign
R9521:Tob1	UTSW	11	94214379	small deletion	probably benign
R9542:Tob1	UTSW	11	94214408	missense	unknown
R9729:Tob1	UTSW	11	94214054	missense	probably damaging	1.00
R9744:Tob1	UTSW	11	94214228	missense	probably damaging	0.99
RF028:Tob1	UTSW	11	94214451	small insertion	probably benign
RF041:Tob1	UTSW	11	94214451	small insertion	probably benign
RF042:Tob1	UTSW	11	94214451	small insertion	probably benign
RF044:Tob1	UTSW	11	94214461	small insertion	probably benign
RF054:Tob1	UTSW	11	94214461	small insertion	probably benign
Z1177:Tob1	UTSW	11	94213992	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- TGTTCATGCCCATAAGCGAC -3'
(R):5'- TCCTTGGCATTGGGAGAAAGAG -3'

Sequencing Primer
(F):5'- ATAAGCGACCCGGCCTC -3'
(R):5'- CAGAGGTTTGCTGCTGCTGC -3'

Posted On

2021-01-18