Incidental Mutation 'R8491:Casc3'
ID 658008
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Name exon junction complex subunit
Synonyms Mln51, Btz
MMRRC Submission 067933-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R8491 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98700634-98724633 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 98713977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 403 (R403L)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect probably benign
Transcript: ENSMUST00000017384
AA Change: R403L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R403L

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169695
AA Change: R403L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R403L

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,903,708 (GRCm39) I44F unknown Het
Agap1 A G 1: 89,537,294 (GRCm39) E100G probably damaging Het
Aoc3 G T 11: 101,223,042 (GRCm39) R426L probably benign Het
Aspm T G 1: 139,385,433 (GRCm39) L359R probably damaging Het
Atp8b2 A G 3: 89,865,676 (GRCm39) S75P probably damaging Het
Bcl9l A G 9: 44,412,065 (GRCm39) E17G probably benign Het
Cdh16 T C 8: 105,343,681 (GRCm39) D605G probably damaging Het
Cdh2 A G 18: 16,757,775 (GRCm39) probably null Het
Cers5 T A 15: 99,638,831 (GRCm39) K161N probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cntnap3 A T 13: 64,933,157 (GRCm39) D454E probably damaging Het
Cxcl15 T A 5: 90,943,089 (GRCm39) C30* probably null Het
Cyp4a12a C A 4: 115,158,650 (GRCm39) probably null Het
Dlc1 A T 8: 37,052,000 (GRCm39) I577N probably benign Het
Dusp6 C A 10: 99,102,081 (GRCm39) R210S possibly damaging Het
Faxc T A 4: 21,993,319 (GRCm39) M321K probably damaging Het
Fez2 C A 17: 78,692,200 (GRCm39) V340L probably benign Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gdnf A G 15: 7,864,272 (GRCm39) I228V possibly damaging Het
Gm12258 A G 11: 58,745,122 (GRCm39) T18A Het
Gm5460 T C 14: 33,761,740 (GRCm39) L194P probably damaging Het
Gm6040 T G 8: 21,407,135 (GRCm39) R28S possibly damaging Het
Gmps A G 3: 63,921,779 (GRCm39) E594G probably benign Het
Hspg2 T C 4: 137,281,030 (GRCm39) V3334A probably benign Het
Idh3a T C 9: 54,506,963 (GRCm39) probably null Het
Ins1 A G 19: 52,252,808 (GRCm39) probably benign Het
Mug1 A T 6: 121,859,688 (GRCm39) D1229V probably damaging Het
Ndufs1 T C 1: 63,196,384 (GRCm39) D347G probably damaging Het
Or52d3 G A 7: 104,229,242 (GRCm39) V130I probably damaging Het
Or8k25 A G 2: 86,244,099 (GRCm39) I99T probably benign Het
Pclo C A 5: 14,565,244 (GRCm39) N3K unknown Het
Pigl A G 11: 62,364,293 (GRCm39) R112G probably null Het
Prkcq T C 2: 11,284,335 (GRCm39) Y502H probably damaging Het
Psg16 T C 7: 16,824,437 (GRCm39) Y74H probably damaging Het
Psme4 G A 11: 30,722,161 (GRCm39) G60D possibly damaging Het
Rpp14 A T 14: 8,083,925 (GRCm38) Q27L possibly damaging Het
Serpini2 A C 3: 75,159,822 (GRCm39) C315G probably damaging Het
Slitrk3 A G 3: 72,958,592 (GRCm39) I60T possibly damaging Het
Svil T C 18: 5,106,678 (GRCm39) Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 (GRCm39) Q548R probably benign Het
Tob1 A G 11: 94,105,115 (GRCm39) D217G probably benign Het
Trim21 A C 7: 102,208,689 (GRCm39) D343E probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Trmt13 T C 3: 116,376,228 (GRCm39) R388G probably benign Het
Ubqlnl A G 7: 103,798,582 (GRCm39) V305A probably benign Het
Ushbp1 A G 8: 71,845,041 (GRCm39) V244A probably benign Het
Vdac2 T A 14: 21,887,838 (GRCm39) N60K possibly damaging Het
Vwa5a A G 9: 38,652,476 (GRCm39) E753G probably damaging Het
Washc4 A G 10: 83,411,987 (GRCm39) D706G probably benign Het
Zbtb5 T C 4: 44,995,090 (GRCm39) D98G probably damaging Het
Zfp53 A G 17: 21,729,621 (GRCm39) I551M probably benign Het
Zfp958 G T 8: 4,676,215 (GRCm39) R61I probably damaging Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98,714,028 (GRCm39) missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98,714,227 (GRCm39) critical splice donor site probably null
IGL01901:Casc3 APN 11 98,713,947 (GRCm39) missense probably damaging 1.00
IGL02345:Casc3 APN 11 98,718,390 (GRCm39) splice site probably benign
IGL02875:Casc3 APN 11 98,712,378 (GRCm39) missense probably damaging 1.00
IGL02964:Casc3 APN 11 98,719,749 (GRCm39) missense probably damaging 0.96
R0147:Casc3 UTSW 11 98,713,325 (GRCm39) missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98,712,319 (GRCm39) missense probably damaging 0.99
R0763:Casc3 UTSW 11 98,722,144 (GRCm39) missense probably damaging 1.00
R1581:Casc3 UTSW 11 98,713,644 (GRCm39) missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98,712,332 (GRCm39) missense probably benign 0.01
R4380:Casc3 UTSW 11 98,713,857 (GRCm39) missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98,713,784 (GRCm39) missense probably benign 0.13
R4988:Casc3 UTSW 11 98,712,700 (GRCm39) splice site probably null
R5079:Casc3 UTSW 11 98,701,252 (GRCm39) intron probably benign
R5442:Casc3 UTSW 11 98,712,297 (GRCm39) missense probably damaging 0.99
R5511:Casc3 UTSW 11 98,701,740 (GRCm39) nonsense probably null
R5873:Casc3 UTSW 11 98,712,270 (GRCm39) missense unknown
R6041:Casc3 UTSW 11 98,719,385 (GRCm39) missense probably damaging 1.00
R6685:Casc3 UTSW 11 98,713,356 (GRCm39) missense probably damaging 0.99
R7030:Casc3 UTSW 11 98,713,359 (GRCm39) missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98,718,413 (GRCm39) missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98,712,311 (GRCm39) missense probably benign 0.04
R7659:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R7660:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R8443:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8444:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8516:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAGCTAGTTACCGGTCAC -3'
(R):5'- TGGCTTGGACTCCAACTTTG -3'

Sequencing Primer
(F):5'- TCACGGCGTCTAGAGCAG -3'
(R):5'- AGCTGCGCCACATCTTG -3'
Posted On 2021-01-18