Mutagenetix > Incidental Mutation

Incidental Mutation 'R8491:Casc3'

658008

Institutional Source

Beutler Lab

Gene Symbol

Casc3

Ensembl Gene

ENSMUSG00000078676

Gene Name

cancer susceptibility candidate 3

Synonyms

Btz, Mln51

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R8491 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98804905-98833814 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 98823151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 403 (R403L)

Ref Sequence

ENSEMBL: ENSMUSP00000130926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]

AlphaFold

Q8K3W3

Predicted Effect

probably benign
Transcript: ENSMUST00000017384
AA Change: R403L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R403L

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169695
AA Change: R403L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R403L

Domain	Start	End	E-Value	Type
low complexity region	18	62	N/A	INTRINSIC
low complexity region	64	84	N/A	INTRINSIC
low complexity region	89	109	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Btz	138	246	1.02e-57	SMART
low complexity region	524	533	N/A	INTRINSIC
low complexity region	586	614	N/A	INTRINSIC
low complexity region	627	648	N/A	INTRINSIC
low complexity region	669	684	N/A	INTRINSIC

Meta Mutation Damage Score

0.1069

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aard	A	T	15: 52,040,312	I44F	unknown	Het
Agap1	A	G	1: 89,609,572	E100G	probably damaging	Het
Aoc3	G	T	11: 101,332,216	R426L	probably benign	Het
Aspm	T	G	1: 139,457,695	L359R	probably damaging	Het
Atp8b2	A	G	3: 89,958,369	S75P	probably damaging	Het
Bcl9l	A	G	9: 44,500,768	E17G	probably benign	Het
Cdh16	T	C	8: 104,617,049	D605G	probably damaging	Het
Cdh2	A	G	18: 16,624,718		probably null	Het
Cers5	T	A	15: 99,740,950	K161N	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cntnap3	A	T	13: 64,785,343	D454E	probably damaging	Het
Cxcl15	T	A	5: 90,795,230	C30*	probably null	Het
Cyp4a12a	C	A	4: 115,301,453		probably null	Het
Dlc1	A	T	8: 36,584,846	I577N	probably benign	Het
Dusp6	C	A	10: 99,266,219	R210S	possibly damaging	Het
Faxc	T	A	4: 21,993,319	M321K	probably damaging	Het
Fez2	C	A	17: 78,384,771	V340L	probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gdnf	A	G	15: 7,834,791	I228V	possibly damaging	Het
Gm12258	A	G	11: 58,854,296	T18A		Het
Gm5460	T	C	14: 34,039,783	L194P	probably damaging	Het
Gm6040	T	G	8: 20,917,119	R28S	possibly damaging	Het
Gmps	A	G	3: 64,014,358	E594G	probably benign	Het
Hspg2	T	C	4: 137,553,719	V3334A	probably benign	Het
Idh3a	T	C	9: 54,599,679		probably null	Het
Ins1	A	G	19: 52,264,370		probably benign	Het
Mug1	A	T	6: 121,882,729	D1229V	probably damaging	Het
Ndufs1	T	C	1: 63,157,225	D347G	probably damaging	Het
Olfr1061	A	G	2: 86,413,755	I99T	probably benign	Het
Olfr653	G	A	7: 104,580,035	V130I	probably damaging	Het
Pclo	C	A	5: 14,515,230	N3K	unknown	Het
Pigl	A	G	11: 62,473,467	R112G	probably null	Het
Prkcq	T	C	2: 11,279,524	Y502H	probably damaging	Het
Psg16	T	C	7: 17,090,512	Y74H	probably damaging	Het
Psme4	G	A	11: 30,772,161	G60D	possibly damaging	Het
Rpp14	A	T	14: 8,083,925	Q27L	possibly damaging	Het
Serpini2	A	C	3: 75,252,515	C315G	probably damaging	Het
Slitrk3	A	G	3: 73,051,259	I60T	possibly damaging	Het
Svil	T	C	18: 5,106,678	Y1436H	probably damaging	Het
Tmem245	T	C	4: 56,906,261	Q548R	probably benign	Het
Tob1	A	G	11: 94,214,289	D217G	probably benign	Het
Trim21	A	C	7: 102,559,482	D343E	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trmt13	T	C	3: 116,582,579	R388G	probably benign	Het
Ubqlnl	A	G	7: 104,149,375	V305A	probably benign	Het
Ushbp1	A	G	8: 71,392,397	V244A	probably benign	Het
Vdac2	T	A	14: 21,837,770	N60K	possibly damaging	Het
Vwa5a	A	G	9: 38,741,180	E753G	probably damaging	Het
Washc4	A	G	10: 83,576,123	D706G	probably benign	Het
Zbtb5	T	C	4: 44,995,090	D98G	probably damaging	Het
Zfp53	A	G	17: 21,509,359	I551M	probably benign	Het
Zfp958	G	T	8: 4,626,215	R61I	probably damaging	Het

Other mutations in Casc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Casc3	APN	11	98823202	missense	possibly damaging	0.62
IGL01566:Casc3	APN	11	98823401	critical splice donor site	probably null
IGL01901:Casc3	APN	11	98823121	missense	probably damaging	1.00
IGL02345:Casc3	APN	11	98827564	splice site	probably benign
IGL02875:Casc3	APN	11	98821552	missense	probably damaging	1.00
IGL02964:Casc3	APN	11	98828923	missense	probably damaging	0.96
R0147:Casc3	UTSW	11	98822499	missense	possibly damaging	0.89
R0195:Casc3	UTSW	11	98821493	missense	probably damaging	0.99
R0763:Casc3	UTSW	11	98831318	missense	probably damaging	1.00
R1581:Casc3	UTSW	11	98822818	missense	possibly damaging	0.66
R2021:Casc3	UTSW	11	98821506	missense	probably benign	0.01
R4380:Casc3	UTSW	11	98823031	missense	possibly damaging	0.67
R4612:Casc3	UTSW	11	98822958	missense	probably benign	0.13
R4988:Casc3	UTSW	11	98821874	splice site	probably null
R5079:Casc3	UTSW	11	98810426	intron	probably benign
R5442:Casc3	UTSW	11	98821471	missense	probably damaging	0.99
R5511:Casc3	UTSW	11	98810914	nonsense	probably null
R5873:Casc3	UTSW	11	98821444	missense	unknown
R6041:Casc3	UTSW	11	98828559	missense	probably damaging	1.00
R6685:Casc3	UTSW	11	98822530	missense	probably damaging	0.99
R7030:Casc3	UTSW	11	98822533	missense	possibly damaging	0.74
R7107:Casc3	UTSW	11	98827587	missense	possibly damaging	0.93
R7594:Casc3	UTSW	11	98821485	missense	probably benign	0.04
R7659:Casc3	UTSW	11	98809873	missense	unknown
R7660:Casc3	UTSW	11	98809873	missense	unknown
R8443:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8444:Casc3	UTSW	11	98822781	missense	probably damaging	1.00
R8516:Casc3	UTSW	11	98822781	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGAAGCTAGTTACCGGTCAC -3'
(R):5'- TGGCTTGGACTCCAACTTTG -3'

Sequencing Primer
(F):5'- TCACGGCGTCTAGAGCAG -3'
(R):5'- AGCTGCGCCACATCTTG -3'

Posted On

2021-01-18