Mutagenetix > Incidental Mutations

Incidental Mutation 'R8491:Cntnap3'

658010

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R8491 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64785343 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 454 (D454E)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: D454E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D454E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aard	A	T	15: 52,040,312	I44F	unknown	Het
Agap1	A	G	1: 89,609,572	E100G	probably damaging	Het
Aoc3	G	T	11: 101,332,216	R426L	probably benign	Het
Aspm	T	G	1: 139,457,695	L359R	probably damaging	Het
Atp8b2	A	G	3: 89,958,369	S75P	probably damaging	Het
Bcl9l	A	G	9: 44,500,768	E17G	probably benign	Het
Casc3	G	T	11: 98,823,151	R403L	probably benign	Het
Cdh16	T	C	8: 104,617,049	D605G	probably damaging	Het
Cdh2	A	G	18: 16,624,718		probably null	Het
Cers5	T	A	15: 99,740,950	K161N	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cxcl15	T	A	5: 90,795,230	C30*	probably null	Het
Cyp4a12a	C	A	4: 115,301,453		probably null	Het
Dlc1	A	T	8: 36,584,846	I577N	probably benign	Het
Dusp6	C	A	10: 99,266,219	R210S	possibly damaging	Het
Faxc	T	A	4: 21,993,319	M321K	probably damaging	Het
Fez2	C	A	17: 78,384,771	V340L	probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gdnf	A	G	15: 7,834,791	I228V	possibly damaging	Het
Gm12258	A	G	11: 58,854,296	T18A		Het
Gm5460	T	C	14: 34,039,783	L194P	probably damaging	Het
Gm6040	T	G	8: 20,917,119	R28S	possibly damaging	Het
Gmps	A	G	3: 64,014,358	E594G	probably benign	Het
Hspg2	T	C	4: 137,553,719	V3334A	probably benign	Het
Idh3a	T	C	9: 54,599,679		probably null	Het
Ins1	A	G	19: 52,264,370		probably benign	Het
Mug1	A	T	6: 121,882,729	D1229V	probably damaging	Het
Ndufs1	T	C	1: 63,157,225	D347G	probably damaging	Het
Olfr1061	A	G	2: 86,413,755	I99T	probably benign	Het
Olfr653	G	A	7: 104,580,035	V130I	probably damaging	Het
Pclo	C	A	5: 14,515,230	N3K	unknown	Het
Pigl	A	G	11: 62,473,467	R112G	probably null	Het
Prkcq	T	C	2: 11,279,524	Y502H	probably damaging	Het
Psg16	T	C	7: 17,090,512	Y74H	probably damaging	Het
Psme4	G	A	11: 30,772,161	G60D	possibly damaging	Het
Rpp14	A	T	14: 8,083,925	Q27L	possibly damaging	Het
Serpini2	A	C	3: 75,252,515	C315G	probably damaging	Het
Slitrk3	A	G	3: 73,051,259	I60T	possibly damaging	Het
Svil	T	C	18: 5,106,678	Y1436H	probably damaging	Het
Tmem245	T	C	4: 56,906,261	Q548R	probably benign	Het
Tob1	A	G	11: 94,214,289	D217G	probably benign	Het
Trim21	A	C	7: 102,559,482	D343E	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trmt13	T	C	3: 116,582,579	R388G	probably benign	Het
Ubqlnl	A	G	7: 104,149,375	V305A	probably benign	Het
Ushbp1	A	G	8: 71,392,397	V244A	probably benign	Het
Vdac2	T	A	14: 21,837,770	N60K	possibly damaging	Het
Vwa5a	A	G	9: 38,741,180	E753G	probably damaging	Het
Washc4	A	G	10: 83,576,123	D706G	probably benign	Het
Zbtb5	T	C	4: 44,995,090	D98G	probably damaging	Het
Zfp53	A	G	17: 21,509,359	I551M	probably benign	Het
Zfp958	G	T	8: 4,626,215	R61I	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTAACATGCCTGTGATGAGAGG -3'
(R):5'- GGATGCCTTAGAGGAGATAATGTTTTC -3'

Sequencing Primer
(F):5'- CAGTGGAGATTATTTGGACCCAC -3'
(R):5'- CTTCGTGTGTTGTCATAATAAATGG -3'

Posted On

2021-01-18