Incidental Mutation 'R8491:Cntnap3'
ID 658010
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 067933-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8491 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64933157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 454 (D454E)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D454E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D454E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,903,708 (GRCm39) I44F unknown Het
Agap1 A G 1: 89,537,294 (GRCm39) E100G probably damaging Het
Aoc3 G T 11: 101,223,042 (GRCm39) R426L probably benign Het
Aspm T G 1: 139,385,433 (GRCm39) L359R probably damaging Het
Atp8b2 A G 3: 89,865,676 (GRCm39) S75P probably damaging Het
Bcl9l A G 9: 44,412,065 (GRCm39) E17G probably benign Het
Casc3 G T 11: 98,713,977 (GRCm39) R403L probably benign Het
Cdh16 T C 8: 105,343,681 (GRCm39) D605G probably damaging Het
Cdh2 A G 18: 16,757,775 (GRCm39) probably null Het
Cers5 T A 15: 99,638,831 (GRCm39) K161N probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cxcl15 T A 5: 90,943,089 (GRCm39) C30* probably null Het
Cyp4a12a C A 4: 115,158,650 (GRCm39) probably null Het
Dlc1 A T 8: 37,052,000 (GRCm39) I577N probably benign Het
Dusp6 C A 10: 99,102,081 (GRCm39) R210S possibly damaging Het
Faxc T A 4: 21,993,319 (GRCm39) M321K probably damaging Het
Fez2 C A 17: 78,692,200 (GRCm39) V340L probably benign Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gdnf A G 15: 7,864,272 (GRCm39) I228V possibly damaging Het
Gm12258 A G 11: 58,745,122 (GRCm39) T18A Het
Gm5460 T C 14: 33,761,740 (GRCm39) L194P probably damaging Het
Gm6040 T G 8: 21,407,135 (GRCm39) R28S possibly damaging Het
Gmps A G 3: 63,921,779 (GRCm39) E594G probably benign Het
Hspg2 T C 4: 137,281,030 (GRCm39) V3334A probably benign Het
Idh3a T C 9: 54,506,963 (GRCm39) probably null Het
Ins1 A G 19: 52,252,808 (GRCm39) probably benign Het
Mug1 A T 6: 121,859,688 (GRCm39) D1229V probably damaging Het
Ndufs1 T C 1: 63,196,384 (GRCm39) D347G probably damaging Het
Or52d3 G A 7: 104,229,242 (GRCm39) V130I probably damaging Het
Or8k25 A G 2: 86,244,099 (GRCm39) I99T probably benign Het
Pclo C A 5: 14,565,244 (GRCm39) N3K unknown Het
Pigl A G 11: 62,364,293 (GRCm39) R112G probably null Het
Prkcq T C 2: 11,284,335 (GRCm39) Y502H probably damaging Het
Psg16 T C 7: 16,824,437 (GRCm39) Y74H probably damaging Het
Psme4 G A 11: 30,722,161 (GRCm39) G60D possibly damaging Het
Rpp14 A T 14: 8,083,925 (GRCm38) Q27L possibly damaging Het
Serpini2 A C 3: 75,159,822 (GRCm39) C315G probably damaging Het
Slitrk3 A G 3: 72,958,592 (GRCm39) I60T possibly damaging Het
Svil T C 18: 5,106,678 (GRCm39) Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 (GRCm39) Q548R probably benign Het
Tob1 A G 11: 94,105,115 (GRCm39) D217G probably benign Het
Trim21 A C 7: 102,208,689 (GRCm39) D343E probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Trmt13 T C 3: 116,376,228 (GRCm39) R388G probably benign Het
Ubqlnl A G 7: 103,798,582 (GRCm39) V305A probably benign Het
Ushbp1 A G 8: 71,845,041 (GRCm39) V244A probably benign Het
Vdac2 T A 14: 21,887,838 (GRCm39) N60K possibly damaging Het
Vwa5a A G 9: 38,652,476 (GRCm39) E753G probably damaging Het
Washc4 A G 10: 83,411,987 (GRCm39) D706G probably benign Het
Zbtb5 T C 4: 44,995,090 (GRCm39) D98G probably damaging Het
Zfp53 A G 17: 21,729,621 (GRCm39) I551M probably benign Het
Zfp958 G T 8: 4,676,215 (GRCm39) R61I probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAACATGCCTGTGATGAGAGG -3'
(R):5'- GGATGCCTTAGAGGAGATAATGTTTTC -3'

Sequencing Primer
(F):5'- CAGTGGAGATTATTTGGACCCAC -3'
(R):5'- CTTCGTGTGTTGTCATAATAAATGG -3'
Posted On 2021-01-18