Incidental Mutation 'R8491:Cntnap3'
ID658010
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8491 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64785343 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 454 (D454E)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D454E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D454E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 52,040,312 I44F unknown Het
Agap1 A G 1: 89,609,572 E100G probably damaging Het
Aoc3 G T 11: 101,332,216 R426L probably benign Het
Aspm T G 1: 139,457,695 L359R probably damaging Het
Atp8b2 A G 3: 89,958,369 S75P probably damaging Het
Bcl9l A G 9: 44,500,768 E17G probably benign Het
Casc3 G T 11: 98,823,151 R403L probably benign Het
Cdh16 T C 8: 104,617,049 D605G probably damaging Het
Cdh2 A G 18: 16,624,718 probably null Het
Cers5 T A 15: 99,740,950 K161N probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cxcl15 T A 5: 90,795,230 C30* probably null Het
Cyp4a12a C A 4: 115,301,453 probably null Het
Dlc1 A T 8: 36,584,846 I577N probably benign Het
Dusp6 C A 10: 99,266,219 R210S possibly damaging Het
Faxc T A 4: 21,993,319 M321K probably damaging Het
Fez2 C A 17: 78,384,771 V340L probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gdnf A G 15: 7,834,791 I228V possibly damaging Het
Gm12258 A G 11: 58,854,296 T18A Het
Gm5460 T C 14: 34,039,783 L194P probably damaging Het
Gm6040 T G 8: 20,917,119 R28S possibly damaging Het
Gmps A G 3: 64,014,358 E594G probably benign Het
Hspg2 T C 4: 137,553,719 V3334A probably benign Het
Idh3a T C 9: 54,599,679 probably null Het
Ins1 A G 19: 52,264,370 probably benign Het
Mug1 A T 6: 121,882,729 D1229V probably damaging Het
Ndufs1 T C 1: 63,157,225 D347G probably damaging Het
Olfr1061 A G 2: 86,413,755 I99T probably benign Het
Olfr653 G A 7: 104,580,035 V130I probably damaging Het
Pclo C A 5: 14,515,230 N3K unknown Het
Pigl A G 11: 62,473,467 R112G probably null Het
Prkcq T C 2: 11,279,524 Y502H probably damaging Het
Psg16 T C 7: 17,090,512 Y74H probably damaging Het
Psme4 G A 11: 30,772,161 G60D possibly damaging Het
Rpp14 A T 14: 8,083,925 Q27L possibly damaging Het
Serpini2 A C 3: 75,252,515 C315G probably damaging Het
Slitrk3 A G 3: 73,051,259 I60T possibly damaging Het
Svil T C 18: 5,106,678 Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tob1 A G 11: 94,214,289 D217G probably benign Het
Trim21 A C 7: 102,559,482 D343E probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trmt13 T C 3: 116,582,579 R388G probably benign Het
Ubqlnl A G 7: 104,149,375 V305A probably benign Het
Ushbp1 A G 8: 71,392,397 V244A probably benign Het
Vdac2 T A 14: 21,837,770 N60K possibly damaging Het
Vwa5a A G 9: 38,741,180 E753G probably damaging Het
Washc4 A G 10: 83,576,123 D706G probably benign Het
Zbtb5 T C 4: 44,995,090 D98G probably damaging Het
Zfp53 A G 17: 21,509,359 I551M probably benign Het
Zfp958 G T 8: 4,626,215 R61I probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAACATGCCTGTGATGAGAGG -3'
(R):5'- GGATGCCTTAGAGGAGATAATGTTTTC -3'

Sequencing Primer
(F):5'- CAGTGGAGATTATTTGGACCCAC -3'
(R):5'- CTTCGTGTGTTGTCATAATAAATGG -3'
Posted On2021-01-18