Incidental Mutation 'R8491:Triobp'
ID 658016
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 067933-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8491 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78878326 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1750 (H1750Y)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109687
AA Change: H363Y

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: H363Y

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: H1704Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: H1704Y

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: H1750Y

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: H1750Y

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088
AA Change: H358Y

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard A T 15: 51,903,708 (GRCm39) I44F unknown Het
Agap1 A G 1: 89,537,294 (GRCm39) E100G probably damaging Het
Aoc3 G T 11: 101,223,042 (GRCm39) R426L probably benign Het
Aspm T G 1: 139,385,433 (GRCm39) L359R probably damaging Het
Atp8b2 A G 3: 89,865,676 (GRCm39) S75P probably damaging Het
Bcl9l A G 9: 44,412,065 (GRCm39) E17G probably benign Het
Casc3 G T 11: 98,713,977 (GRCm39) R403L probably benign Het
Cdh16 T C 8: 105,343,681 (GRCm39) D605G probably damaging Het
Cdh2 A G 18: 16,757,775 (GRCm39) probably null Het
Cers5 T A 15: 99,638,831 (GRCm39) K161N probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cntnap3 A T 13: 64,933,157 (GRCm39) D454E probably damaging Het
Cxcl15 T A 5: 90,943,089 (GRCm39) C30* probably null Het
Cyp4a12a C A 4: 115,158,650 (GRCm39) probably null Het
Dlc1 A T 8: 37,052,000 (GRCm39) I577N probably benign Het
Dusp6 C A 10: 99,102,081 (GRCm39) R210S possibly damaging Het
Faxc T A 4: 21,993,319 (GRCm39) M321K probably damaging Het
Fez2 C A 17: 78,692,200 (GRCm39) V340L probably benign Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gdnf A G 15: 7,864,272 (GRCm39) I228V possibly damaging Het
Gm12258 A G 11: 58,745,122 (GRCm39) T18A Het
Gm5460 T C 14: 33,761,740 (GRCm39) L194P probably damaging Het
Gm6040 T G 8: 21,407,135 (GRCm39) R28S possibly damaging Het
Gmps A G 3: 63,921,779 (GRCm39) E594G probably benign Het
Hspg2 T C 4: 137,281,030 (GRCm39) V3334A probably benign Het
Idh3a T C 9: 54,506,963 (GRCm39) probably null Het
Ins1 A G 19: 52,252,808 (GRCm39) probably benign Het
Mug1 A T 6: 121,859,688 (GRCm39) D1229V probably damaging Het
Ndufs1 T C 1: 63,196,384 (GRCm39) D347G probably damaging Het
Or52d3 G A 7: 104,229,242 (GRCm39) V130I probably damaging Het
Or8k25 A G 2: 86,244,099 (GRCm39) I99T probably benign Het
Pclo C A 5: 14,565,244 (GRCm39) N3K unknown Het
Pigl A G 11: 62,364,293 (GRCm39) R112G probably null Het
Prkcq T C 2: 11,284,335 (GRCm39) Y502H probably damaging Het
Psg16 T C 7: 16,824,437 (GRCm39) Y74H probably damaging Het
Psme4 G A 11: 30,722,161 (GRCm39) G60D possibly damaging Het
Rpp14 A T 14: 8,083,925 (GRCm38) Q27L possibly damaging Het
Serpini2 A C 3: 75,159,822 (GRCm39) C315G probably damaging Het
Slitrk3 A G 3: 72,958,592 (GRCm39) I60T possibly damaging Het
Svil T C 18: 5,106,678 (GRCm39) Y1436H probably damaging Het
Tmem245 T C 4: 56,906,261 (GRCm39) Q548R probably benign Het
Tob1 A G 11: 94,105,115 (GRCm39) D217G probably benign Het
Trim21 A C 7: 102,208,689 (GRCm39) D343E probably benign Het
Trmt13 T C 3: 116,376,228 (GRCm39) R388G probably benign Het
Ubqlnl A G 7: 103,798,582 (GRCm39) V305A probably benign Het
Ushbp1 A G 8: 71,845,041 (GRCm39) V244A probably benign Het
Vdac2 T A 14: 21,887,838 (GRCm39) N60K possibly damaging Het
Vwa5a A G 9: 38,652,476 (GRCm39) E753G probably damaging Het
Washc4 A G 10: 83,411,987 (GRCm39) D706G probably benign Het
Zbtb5 T C 4: 44,995,090 (GRCm39) D98G probably damaging Het
Zfp53 A G 17: 21,729,621 (GRCm39) I551M probably benign Het
Zfp958 G T 8: 4,676,215 (GRCm39) R61I probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAACCTGGGGAAGCTG -3'
(R):5'- GAGGTCCAAGTGCAGACTAG -3'

Sequencing Primer
(F):5'- CTGGGCTTGTGGCGTATG -3'
(R):5'- CCTTGTCTGTAAAATGGGCACAG -3'
Posted On 2021-01-18