Incidental Mutation 'R8492:Als2'
ID658023
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R8492 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59211344 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 414 (K414E)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000160945] [ENSMUST00000163058]
Predicted Effect probably damaging
Transcript: ENSMUST00000027178
AA Change: K414E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: K414E

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160945
SMART Domains Protein: ENSMUSP00000140990
Gene: ENSMUSG00000026024

DomainStartEndE-ValueType
Pfam:RCC1 1 52 3.3e-8 PFAM
Pfam:RCC1_2 39 66 4.1e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163058
AA Change: K414E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: K414E

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,218,247 R43K possibly damaging Het
Abcc2 A T 19: 43,804,971 Y354F probably benign Het
Aloxe3 A T 11: 69,126,475 T25S possibly damaging Het
Ankmy2 A T 12: 36,176,591 I95F probably damaging Het
Ankrd35 T G 3: 96,682,213 probably null Het
Ap3b1 A G 13: 94,394,786 N91S possibly damaging Het
Apip T A 2: 103,092,521 L228H probably damaging Het
Arhgap23 A G 11: 97,475,021 Y488C probably damaging Het
Asah2 G A 19: 32,006,259 T595M probably benign Het
Ccdc174 G C 6: 91,888,157 R132T probably benign Het
Ccng2 A C 5: 93,271,454 H233P probably damaging Het
Cemip A G 7: 83,973,214 F586L probably damaging Het
Cenpf A G 1: 189,658,729 S969P probably damaging Het
Cep170b G A 12: 112,744,700 D1505N probably damaging Het
Colec12 T A 18: 9,876,980 probably null Het
Cytip A G 2: 58,137,857 probably null Het
D630045J12Rik A T 6: 38,190,590 S1026T probably damaging Het
Disc1 T A 8: 125,090,438 D372E probably damaging Het
Dlgap2 A T 8: 14,778,271 M560L possibly damaging Het
Dync2li1 C A 17: 84,649,706 probably null Het
Eif3c C T 7: 126,563,110 G180D probably damaging Het
Fam35a T A 14: 34,245,232 K122N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
G6pc2 A G 2: 69,220,242 I70M probably damaging Het
Gm5145 A T 17: 20,570,419 I20F probably damaging Het
Hba-x T A 11: 32,277,921 F128L probably benign Het
Hspb1 G A 5: 135,889,368 E190K possibly damaging Het
Ift122 T A 6: 115,887,005 S246T probably benign Het
Inppl1 A T 7: 101,826,778 S828T probably damaging Het
Krt84 C A 15: 101,529,616 Q301H probably damaging Het
Malrd1 T G 2: 15,610,123 S250A Het
Mettl21e A G 1: 44,206,393 I231T probably damaging Het
Miip T C 4: 147,861,424 D341G probably damaging Het
Ncoa1 T C 12: 4,263,473 D1287G probably damaging Het
Ndufb5 T G 3: 32,751,228 probably null Het
Neb T C 2: 52,313,212 E309G probably damaging Het
Nf1 T A 11: 79,408,422 F199I probably benign Het
Olfr360 T A 2: 37,068,683 I126N probably damaging Het
Pcdhgc3 T A 18: 37,807,294 Y249* probably null Het
Plekhg3 G T 12: 76,576,016 V677L probably benign Het
Ppm1f T C 16: 16,915,178 Y25H probably damaging Het
Prok2 A T 6: 99,714,476 H75Q probably benign Het
Ralgapa2 A T 2: 146,342,604 H1494Q possibly damaging Het
Rapgef6 T G 11: 54,690,237 I1277S probably damaging Het
Rhob G T 12: 8,499,531 Y34* probably null Het
Rnf141 T G 7: 110,837,200 D7A probably benign Het
Robo1 T C 16: 73,013,023 S1220P probably benign Het
Rpl13a A G 7: 45,126,521 V48A possibly damaging Het
Serpinb9f C A 13: 33,334,604 H362Q probably damaging Het
Slc22a8 G T 19: 8,594,231 V109L probably damaging Het
Slc5a10 A G 11: 61,673,983 V390A probably benign Het
Snx14 T C 9: 88,381,816 N839D possibly damaging Het
Taf1c G A 8: 119,598,717 T802I probably benign Het
Tdh C A 14: 63,492,820 D337Y probably damaging Het
Tmem156 A T 5: 65,065,095 Y255N possibly damaging Het
Tmpo C A 10: 91,161,858 R689L probably benign Het
Trim56 A C 5: 137,112,929 C578G probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trpv3 G A 11: 73,288,209 W481* probably null Het
Tssk3 T C 4: 129,489,652 M76V probably benign Het
Vmn1r215 A T 13: 23,075,886 Y32F possibly damaging Het
Vmn1r53 A G 6: 90,223,412 I310T possibly damaging Het
Vmn2r112 A G 17: 22,602,489 T148A probably benign Het
Zdhhc14 G A 17: 5,712,414 V198I probably damaging Het
Zfp109 T C 7: 24,228,074 R637G possibly damaging Het
Zic5 G T 14: 122,465,062 Q86K unknown Het
Zzef1 T G 11: 72,872,604 V1359G probably damaging Het
Zzef1 T A 11: 72,886,746 M1801K probably damaging Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
R8478:Als2 UTSW 1 59186016 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAATGCACTGAGGCATTACC -3'
(R):5'- CAGATCGCCTTTGGATCTGTTTTAG -3'

Sequencing Primer
(F):5'- TTGCGACAACAACCCTGGG -3'
(R):5'- GCTATAAGCATTAAACTACTGACTGC -3'
Posted On2021-01-18