Incidental Mutation 'R8492:Miip'
ID 658035
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 067934-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 147945881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 341 (D341G)
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably damaging
Transcript: ENSMUST00000030886
AA Change: D341G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: D341G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119975
AA Change: D341G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: D341G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172710
AA Change: D341G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: D341G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Meta Mutation Damage Score 0.1725 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,094,243 (GRCm39) R43K possibly damaging Het
Abcc2 A T 19: 43,793,410 (GRCm39) Y354F probably benign Het
Aloxe3 A T 11: 69,017,301 (GRCm39) T25S possibly damaging Het
Als2 T C 1: 59,250,503 (GRCm39) K414E probably damaging Het
Ankmy2 A T 12: 36,226,590 (GRCm39) I95F probably damaging Het
Ankrd35 T G 3: 96,589,529 (GRCm39) probably null Het
Ap3b1 A G 13: 94,531,294 (GRCm39) N91S possibly damaging Het
Apip T A 2: 102,922,866 (GRCm39) L228H probably damaging Het
Arhgap23 A G 11: 97,365,847 (GRCm39) Y488C probably damaging Het
Asah2 G A 19: 31,983,659 (GRCm39) T595M probably benign Het
Ccdc174 G C 6: 91,865,138 (GRCm39) R132T probably benign Het
Ccng2 A C 5: 93,419,313 (GRCm39) H233P probably damaging Het
Cemip A G 7: 83,622,422 (GRCm39) F586L probably damaging Het
Cenpf A G 1: 189,390,926 (GRCm39) S969P probably damaging Het
Cep170b G A 12: 112,711,134 (GRCm39) D1505N probably damaging Het
Colec12 T A 18: 9,876,980 (GRCm39) probably null Het
Cytip A G 2: 58,027,869 (GRCm39) probably null Het
D630045J12Rik A T 6: 38,167,525 (GRCm39) S1026T probably damaging Het
Disc1 T A 8: 125,817,177 (GRCm39) D372E probably damaging Het
Dlgap2 A T 8: 14,828,271 (GRCm39) M560L possibly damaging Het
Dync2li1 C A 17: 84,957,134 (GRCm39) probably null Het
Eif3c C T 7: 126,162,282 (GRCm39) G180D probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
G6pc2 A G 2: 69,050,586 (GRCm39) I70M probably damaging Het
Gm5145 A T 17: 20,790,681 (GRCm39) I20F probably damaging Het
Hba-x T A 11: 32,227,921 (GRCm39) F128L probably benign Het
Hspb1 G A 5: 135,918,222 (GRCm39) E190K possibly damaging Het
Ift122 T A 6: 115,863,966 (GRCm39) S246T probably benign Het
Inppl1 A T 7: 101,475,985 (GRCm39) S828T probably damaging Het
Krt84 C A 15: 101,438,051 (GRCm39) Q301H probably damaging Het
Malrd1 T G 2: 15,614,934 (GRCm39) S250A Het
Mettl21e A G 1: 44,245,553 (GRCm39) I231T probably damaging Het
Ncoa1 T C 12: 4,313,473 (GRCm39) D1287G probably damaging Het
Ndufb5 T G 3: 32,805,377 (GRCm39) probably null Het
Neb T C 2: 52,203,224 (GRCm39) E309G probably damaging Het
Nf1 T A 11: 79,299,248 (GRCm39) F199I probably benign Het
Or12k7 T A 2: 36,958,695 (GRCm39) I126N probably damaging Het
Pcdhgc3 T A 18: 37,940,347 (GRCm39) Y249* probably null Het
Plekhg3 G T 12: 76,622,790 (GRCm39) V677L probably benign Het
Ppm1f T C 16: 16,733,042 (GRCm39) Y25H probably damaging Het
Prok2 A T 6: 99,691,437 (GRCm39) H75Q probably benign Het
Ralgapa2 A T 2: 146,184,524 (GRCm39) H1494Q possibly damaging Het
Rapgef6 T G 11: 54,581,063 (GRCm39) I1277S probably damaging Het
Rhob G T 12: 8,549,531 (GRCm39) Y34* probably null Het
Rnf141 T G 7: 110,436,407 (GRCm39) D7A probably benign Het
Robo1 T C 16: 72,809,911 (GRCm39) S1220P probably benign Het
Rpl13a A G 7: 44,775,945 (GRCm39) V48A possibly damaging Het
Serpinb9f C A 13: 33,518,587 (GRCm39) H362Q probably damaging Het
Shld2 T A 14: 33,967,189 (GRCm39) K122N probably damaging Het
Slc22a8 G T 19: 8,571,595 (GRCm39) V109L probably damaging Het
Slc5a10 A G 11: 61,564,809 (GRCm39) V390A probably benign Het
Snx14 T C 9: 88,263,869 (GRCm39) N839D possibly damaging Het
Taf1c G A 8: 120,325,456 (GRCm39) T802I probably benign Het
Tdh C A 14: 63,730,269 (GRCm39) D337Y probably damaging Het
Tmem156 A T 5: 65,222,438 (GRCm39) Y255N possibly damaging Het
Tmpo C A 10: 90,997,720 (GRCm39) R689L probably benign Het
Trim56 A C 5: 137,141,783 (GRCm39) C578G probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Trpv3 G A 11: 73,179,035 (GRCm39) W481* probably null Het
Tssk3 T C 4: 129,383,445 (GRCm39) M76V probably benign Het
Vmn1r215 A T 13: 23,260,056 (GRCm39) Y32F possibly damaging Het
Vmn1r53 A G 6: 90,200,394 (GRCm39) I310T possibly damaging Het
Vmn2r112 A G 17: 22,821,470 (GRCm39) T148A probably benign Het
Zdhhc14 G A 17: 5,762,689 (GRCm39) V198I probably damaging Het
Zfp109 T C 7: 23,927,499 (GRCm39) R637G possibly damaging Het
Zic5 G T 14: 122,702,474 (GRCm39) Q86K unknown Het
Zzef1 T A 11: 72,777,572 (GRCm39) M1801K probably damaging Het
Zzef1 T G 11: 72,763,430 (GRCm39) V1359G probably damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1647:Miip UTSW 4 147,949,691 (GRCm39) missense probably benign 0.02
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R1944:Miip UTSW 4 147,950,422 (GRCm39) missense probably benign 0.15
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R5183:Miip UTSW 4 147,947,526 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7639:Miip UTSW 4 147,947,021 (GRCm39) missense probably benign 0.22
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8852:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R9755:Miip UTSW 4 147,950,319 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGGAGTGTCAAAGTTACATGGG -3'
(R):5'- GTGGCCAGGTCAACACAAAC -3'

Sequencing Primer
(F):5'- TGGGACACCTTTGTCAGA -3'
(R):5'- CAAACTGAGTTTGGGGTGACC -3'
Posted On 2021-01-18