Incidental Mutation 'R8492:Ccdc174'
ID 658042
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Name coiled-coil domain containing 174
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91878053-91899843 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 91888157 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Threonine at position 132 (R132T)
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037783
AA Change: R132T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: R132T

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,218,247 R43K possibly damaging Het
Abcc2 A T 19: 43,804,971 Y354F probably benign Het
Aloxe3 A T 11: 69,126,475 T25S possibly damaging Het
Als2 T C 1: 59,211,344 K414E probably damaging Het
Ankmy2 A T 12: 36,176,591 I95F probably damaging Het
Ankrd35 T G 3: 96,682,213 probably null Het
Ap3b1 A G 13: 94,394,786 N91S possibly damaging Het
Apip T A 2: 103,092,521 L228H probably damaging Het
Arhgap23 A G 11: 97,475,021 Y488C probably damaging Het
Asah2 G A 19: 32,006,259 T595M probably benign Het
Ccng2 A C 5: 93,271,454 H233P probably damaging Het
Cemip A G 7: 83,973,214 F586L probably damaging Het
Cenpf A G 1: 189,658,729 S969P probably damaging Het
Cep170b G A 12: 112,744,700 D1505N probably damaging Het
Colec12 T A 18: 9,876,980 probably null Het
Cytip A G 2: 58,137,857 probably null Het
D630045J12Rik A T 6: 38,190,590 S1026T probably damaging Het
Disc1 T A 8: 125,090,438 D372E probably damaging Het
Dlgap2 A T 8: 14,778,271 M560L possibly damaging Het
Dync2li1 C A 17: 84,649,706 probably null Het
Eif3c C T 7: 126,563,110 G180D probably damaging Het
Fam35a T A 14: 34,245,232 K122N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
G6pc2 A G 2: 69,220,242 I70M probably damaging Het
Gm5145 A T 17: 20,570,419 I20F probably damaging Het
Hba-x T A 11: 32,277,921 F128L probably benign Het
Hspb1 G A 5: 135,889,368 E190K possibly damaging Het
Ift122 T A 6: 115,887,005 S246T probably benign Het
Inppl1 A T 7: 101,826,778 S828T probably damaging Het
Krt84 C A 15: 101,529,616 Q301H probably damaging Het
Malrd1 T G 2: 15,610,123 S250A Het
Mettl21e A G 1: 44,206,393 I231T probably damaging Het
Miip T C 4: 147,861,424 D341G probably damaging Het
Ncoa1 T C 12: 4,263,473 D1287G probably damaging Het
Ndufb5 T G 3: 32,751,228 probably null Het
Neb T C 2: 52,313,212 E309G probably damaging Het
Nf1 T A 11: 79,408,422 F199I probably benign Het
Olfr360 T A 2: 37,068,683 I126N probably damaging Het
Pcdhgc3 T A 18: 37,807,294 Y249* probably null Het
Plekhg3 G T 12: 76,576,016 V677L probably benign Het
Ppm1f T C 16: 16,915,178 Y25H probably damaging Het
Prok2 A T 6: 99,714,476 H75Q probably benign Het
Ralgapa2 A T 2: 146,342,604 H1494Q possibly damaging Het
Rapgef6 T G 11: 54,690,237 I1277S probably damaging Het
Rhob G T 12: 8,499,531 Y34* probably null Het
Rnf141 T G 7: 110,837,200 D7A probably benign Het
Robo1 T C 16: 73,013,023 S1220P probably benign Het
Rpl13a A G 7: 45,126,521 V48A possibly damaging Het
Serpinb9f C A 13: 33,334,604 H362Q probably damaging Het
Slc22a8 G T 19: 8,594,231 V109L probably damaging Het
Slc5a10 A G 11: 61,673,983 V390A probably benign Het
Snx14 T C 9: 88,381,816 N839D possibly damaging Het
Taf1c G A 8: 119,598,717 T802I probably benign Het
Tdh C A 14: 63,492,820 D337Y probably damaging Het
Tmem156 A T 5: 65,065,095 Y255N possibly damaging Het
Tmpo C A 10: 91,161,858 R689L probably benign Het
Trim56 A C 5: 137,112,929 C578G probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trpv3 G A 11: 73,288,209 W481* probably null Het
Tssk3 T C 4: 129,489,652 M76V probably benign Het
Vmn1r215 A T 13: 23,075,886 Y32F possibly damaging Het
Vmn1r53 A G 6: 90,223,412 I310T possibly damaging Het
Vmn2r112 A G 17: 22,602,489 T148A probably benign Het
Zdhhc14 G A 17: 5,712,414 V198I probably damaging Het
Zfp109 T C 7: 24,228,074 R637G possibly damaging Het
Zic5 G T 14: 122,465,062 Q86K unknown Het
Zzef1 T G 11: 72,872,604 V1359G probably damaging Het
Zzef1 T A 11: 72,886,746 M1801K probably damaging Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91880362 critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91898282 missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91899557 missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91890853 missense probably benign
R0482:Ccdc174 UTSW 6 91895266 missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91890892 splice site probably benign
R0801:Ccdc174 UTSW 6 91895332 missense possibly damaging 0.72
R1124:Ccdc174 UTSW 6 91899580 missense probably benign 0.33
R1237:Ccdc174 UTSW 6 91890787 splice site probably benign
R1388:Ccdc174 UTSW 6 91881244 splice site probably null
R2176:Ccdc174 UTSW 6 91888089 missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91899357 missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91885356 nonsense probably null
R4775:Ccdc174 UTSW 6 91890894 splice site probably null
R4880:Ccdc174 UTSW 6 91899591 unclassified probably benign
R5579:Ccdc174 UTSW 6 91881350 splice site probably null
R5787:Ccdc174 UTSW 6 91881310 nonsense probably null
R5869:Ccdc174 UTSW 6 91885418 utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91880291 missense probably damaging 1.00
RF008:Ccdc174 UTSW 6 91899366 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AACAGTCAGACAATGGGGCC -3'
(R):5'- TGGTTCTTGGAAAACAGAAAACCC -3'

Sequencing Primer
(F):5'- TCAGACAATGGGGCCCTTCTC -3'
(R):5'- CTTGGAAAACAGAAAACCCAGGCAG -3'
Posted On 2021-01-18