Incidental Mutation 'R8492:Ccdc174'
ID 658042
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Name coiled-coil domain containing 174
Synonyms C130022K22Rik
MMRRC Submission 067934-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91855034-91876824 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 91865138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Threonine at position 132 (R132T)
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037783
AA Change: R132T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: R132T

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,094,243 (GRCm39) R43K possibly damaging Het
Abcc2 A T 19: 43,793,410 (GRCm39) Y354F probably benign Het
Aloxe3 A T 11: 69,017,301 (GRCm39) T25S possibly damaging Het
Als2 T C 1: 59,250,503 (GRCm39) K414E probably damaging Het
Ankmy2 A T 12: 36,226,590 (GRCm39) I95F probably damaging Het
Ankrd35 T G 3: 96,589,529 (GRCm39) probably null Het
Ap3b1 A G 13: 94,531,294 (GRCm39) N91S possibly damaging Het
Apip T A 2: 102,922,866 (GRCm39) L228H probably damaging Het
Arhgap23 A G 11: 97,365,847 (GRCm39) Y488C probably damaging Het
Asah2 G A 19: 31,983,659 (GRCm39) T595M probably benign Het
Ccng2 A C 5: 93,419,313 (GRCm39) H233P probably damaging Het
Cemip A G 7: 83,622,422 (GRCm39) F586L probably damaging Het
Cenpf A G 1: 189,390,926 (GRCm39) S969P probably damaging Het
Cep170b G A 12: 112,711,134 (GRCm39) D1505N probably damaging Het
Colec12 T A 18: 9,876,980 (GRCm39) probably null Het
Cytip A G 2: 58,027,869 (GRCm39) probably null Het
D630045J12Rik A T 6: 38,167,525 (GRCm39) S1026T probably damaging Het
Disc1 T A 8: 125,817,177 (GRCm39) D372E probably damaging Het
Dlgap2 A T 8: 14,828,271 (GRCm39) M560L possibly damaging Het
Dync2li1 C A 17: 84,957,134 (GRCm39) probably null Het
Eif3c C T 7: 126,162,282 (GRCm39) G180D probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
G6pc2 A G 2: 69,050,586 (GRCm39) I70M probably damaging Het
Gm5145 A T 17: 20,790,681 (GRCm39) I20F probably damaging Het
Hba-x T A 11: 32,227,921 (GRCm39) F128L probably benign Het
Hspb1 G A 5: 135,918,222 (GRCm39) E190K possibly damaging Het
Ift122 T A 6: 115,863,966 (GRCm39) S246T probably benign Het
Inppl1 A T 7: 101,475,985 (GRCm39) S828T probably damaging Het
Krt84 C A 15: 101,438,051 (GRCm39) Q301H probably damaging Het
Malrd1 T G 2: 15,614,934 (GRCm39) S250A Het
Mettl21e A G 1: 44,245,553 (GRCm39) I231T probably damaging Het
Miip T C 4: 147,945,881 (GRCm39) D341G probably damaging Het
Ncoa1 T C 12: 4,313,473 (GRCm39) D1287G probably damaging Het
Ndufb5 T G 3: 32,805,377 (GRCm39) probably null Het
Neb T C 2: 52,203,224 (GRCm39) E309G probably damaging Het
Nf1 T A 11: 79,299,248 (GRCm39) F199I probably benign Het
Or12k7 T A 2: 36,958,695 (GRCm39) I126N probably damaging Het
Pcdhgc3 T A 18: 37,940,347 (GRCm39) Y249* probably null Het
Plekhg3 G T 12: 76,622,790 (GRCm39) V677L probably benign Het
Ppm1f T C 16: 16,733,042 (GRCm39) Y25H probably damaging Het
Prok2 A T 6: 99,691,437 (GRCm39) H75Q probably benign Het
Ralgapa2 A T 2: 146,184,524 (GRCm39) H1494Q possibly damaging Het
Rapgef6 T G 11: 54,581,063 (GRCm39) I1277S probably damaging Het
Rhob G T 12: 8,549,531 (GRCm39) Y34* probably null Het
Rnf141 T G 7: 110,436,407 (GRCm39) D7A probably benign Het
Robo1 T C 16: 72,809,911 (GRCm39) S1220P probably benign Het
Rpl13a A G 7: 44,775,945 (GRCm39) V48A possibly damaging Het
Serpinb9f C A 13: 33,518,587 (GRCm39) H362Q probably damaging Het
Shld2 T A 14: 33,967,189 (GRCm39) K122N probably damaging Het
Slc22a8 G T 19: 8,571,595 (GRCm39) V109L probably damaging Het
Slc5a10 A G 11: 61,564,809 (GRCm39) V390A probably benign Het
Snx14 T C 9: 88,263,869 (GRCm39) N839D possibly damaging Het
Taf1c G A 8: 120,325,456 (GRCm39) T802I probably benign Het
Tdh C A 14: 63,730,269 (GRCm39) D337Y probably damaging Het
Tmem156 A T 5: 65,222,438 (GRCm39) Y255N possibly damaging Het
Tmpo C A 10: 90,997,720 (GRCm39) R689L probably benign Het
Trim56 A C 5: 137,141,783 (GRCm39) C578G probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Trpv3 G A 11: 73,179,035 (GRCm39) W481* probably null Het
Tssk3 T C 4: 129,383,445 (GRCm39) M76V probably benign Het
Vmn1r215 A T 13: 23,260,056 (GRCm39) Y32F possibly damaging Het
Vmn1r53 A G 6: 90,200,394 (GRCm39) I310T possibly damaging Het
Vmn2r112 A G 17: 22,821,470 (GRCm39) T148A probably benign Het
Zdhhc14 G A 17: 5,762,689 (GRCm39) V198I probably damaging Het
Zfp109 T C 7: 23,927,499 (GRCm39) R637G possibly damaging Het
Zic5 G T 14: 122,702,474 (GRCm39) Q86K unknown Het
Zzef1 T A 11: 72,777,572 (GRCm39) M1801K probably damaging Het
Zzef1 T G 11: 72,763,430 (GRCm39) V1359G probably damaging Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91,857,343 (GRCm39) critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91,875,263 (GRCm39) missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91,876,538 (GRCm39) missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91,867,834 (GRCm39) missense probably benign
R0482:Ccdc174 UTSW 6 91,872,247 (GRCm39) missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91,867,873 (GRCm39) splice site probably benign
R0801:Ccdc174 UTSW 6 91,872,313 (GRCm39) missense possibly damaging 0.72
R1124:Ccdc174 UTSW 6 91,876,561 (GRCm39) missense probably benign 0.33
R1237:Ccdc174 UTSW 6 91,867,768 (GRCm39) splice site probably benign
R1388:Ccdc174 UTSW 6 91,858,225 (GRCm39) splice site probably null
R2176:Ccdc174 UTSW 6 91,865,070 (GRCm39) missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91,876,338 (GRCm39) missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91,862,337 (GRCm39) nonsense probably null
R4775:Ccdc174 UTSW 6 91,867,875 (GRCm39) splice site probably null
R4880:Ccdc174 UTSW 6 91,876,572 (GRCm39) unclassified probably benign
R5579:Ccdc174 UTSW 6 91,858,331 (GRCm39) splice site probably null
R5787:Ccdc174 UTSW 6 91,858,291 (GRCm39) nonsense probably null
R5869:Ccdc174 UTSW 6 91,862,399 (GRCm39) utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91,857,272 (GRCm39) missense probably damaging 1.00
RF008:Ccdc174 UTSW 6 91,876,347 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AACAGTCAGACAATGGGGCC -3'
(R):5'- TGGTTCTTGGAAAACAGAAAACCC -3'

Sequencing Primer
(F):5'- TCAGACAATGGGGCCCTTCTC -3'
(R):5'- CTTGGAAAACAGAAAACCCAGGCAG -3'
Posted On 2021-01-18