Mutagenetix > Incidental Mutation

Incidental Mutation 'R8492:Ap3b1'

658073

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.408) question?

Stock #

R8492 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94394786 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 91 (N91S)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022196
AA Change: N91S

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N91S

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	G	A	10: 29,218,247	R43K	possibly damaging	Het
Abcc2	A	T	19: 43,804,971	Y354F	probably benign	Het
Aloxe3	A	T	11: 69,126,475	T25S	possibly damaging	Het
Als2	T	C	1: 59,211,344	K414E	probably damaging	Het
Ankmy2	A	T	12: 36,176,591	I95F	probably damaging	Het
Ankrd35	T	G	3: 96,682,213		probably null	Het
Apip	T	A	2: 103,092,521	L228H	probably damaging	Het
Arhgap23	A	G	11: 97,475,021	Y488C	probably damaging	Het
Asah2	G	A	19: 32,006,259	T595M	probably benign	Het
Ccdc174	G	C	6: 91,888,157	R132T	probably benign	Het
Ccng2	A	C	5: 93,271,454	H233P	probably damaging	Het
Cemip	A	G	7: 83,973,214	F586L	probably damaging	Het
Cenpf	A	G	1: 189,658,729	S969P	probably damaging	Het
Cep170b	G	A	12: 112,744,700	D1505N	probably damaging	Het
Colec12	T	A	18: 9,876,980		probably null	Het
Cytip	A	G	2: 58,137,857		probably null	Het
D630045J12Rik	A	T	6: 38,190,590	S1026T	probably damaging	Het
Disc1	T	A	8: 125,090,438	D372E	probably damaging	Het
Dlgap2	A	T	8: 14,778,271	M560L	possibly damaging	Het
Dync2li1	C	A	17: 84,649,706		probably null	Het
Eif3c	C	T	7: 126,563,110	G180D	probably damaging	Het
Fam35a	T	A	14: 34,245,232	K122N	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
G6pc2	A	G	2: 69,220,242	I70M	probably damaging	Het
Gm5145	A	T	17: 20,570,419	I20F	probably damaging	Het
Hba-x	T	A	11: 32,277,921	F128L	probably benign	Het
Hspb1	G	A	5: 135,889,368	E190K	possibly damaging	Het
Ift122	T	A	6: 115,887,005	S246T	probably benign	Het
Inppl1	A	T	7: 101,826,778	S828T	probably damaging	Het
Krt84	C	A	15: 101,529,616	Q301H	probably damaging	Het
Malrd1	T	G	2: 15,610,123	S250A		Het
Mettl21e	A	G	1: 44,206,393	I231T	probably damaging	Het
Miip	T	C	4: 147,861,424	D341G	probably damaging	Het
Ncoa1	T	C	12: 4,263,473	D1287G	probably damaging	Het
Ndufb5	T	G	3: 32,751,228		probably null	Het
Neb	T	C	2: 52,313,212	E309G	probably damaging	Het
Nf1	T	A	11: 79,408,422	F199I	probably benign	Het
Olfr360	T	A	2: 37,068,683	I126N	probably damaging	Het
Pcdhgc3	T	A	18: 37,807,294	Y249*	probably null	Het
Plekhg3	G	T	12: 76,576,016	V677L	probably benign	Het
Ppm1f	T	C	16: 16,915,178	Y25H	probably damaging	Het
Prok2	A	T	6: 99,714,476	H75Q	probably benign	Het
Ralgapa2	A	T	2: 146,342,604	H1494Q	possibly damaging	Het
Rapgef6	T	G	11: 54,690,237	I1277S	probably damaging	Het
Rhob	G	T	12: 8,499,531	Y34*	probably null	Het
Rnf141	T	G	7: 110,837,200	D7A	probably benign	Het
Robo1	T	C	16: 73,013,023	S1220P	probably benign	Het
Rpl13a	A	G	7: 45,126,521	V48A	possibly damaging	Het
Serpinb9f	C	A	13: 33,334,604	H362Q	probably damaging	Het
Slc22a8	G	T	19: 8,594,231	V109L	probably damaging	Het
Slc5a10	A	G	11: 61,673,983	V390A	probably benign	Het
Snx14	T	C	9: 88,381,816	N839D	possibly damaging	Het
Taf1c	G	A	8: 119,598,717	T802I	probably benign	Het
Tdh	C	A	14: 63,492,820	D337Y	probably damaging	Het
Tmem156	A	T	5: 65,065,095	Y255N	possibly damaging	Het
Tmpo	C	A	10: 91,161,858	R689L	probably benign	Het
Trim56	A	C	5: 137,112,929	C578G	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trpv3	G	A	11: 73,288,209	W481*	probably null	Het
Tssk3	T	C	4: 129,489,652	M76V	probably benign	Het
Vmn1r215	A	T	13: 23,075,886	Y32F	possibly damaging	Het
Vmn1r53	A	G	6: 90,223,412	I310T	possibly damaging	Het
Vmn2r112	A	G	17: 22,602,489	T148A	probably benign	Het
Zdhhc14	G	A	17: 5,712,414	V198I	probably damaging	Het
Zfp109	T	C	7: 24,228,074	R637G	possibly damaging	Het
Zic5	G	T	14: 122,465,062	Q86K	unknown	Het
Zzef1	T	G	11: 72,872,604	V1359G	probably damaging	Het
Zzef1	T	A	11: 72,886,746	M1801K	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451087	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCATGGAGCTTGCTTTGTGAC -3'
(R):5'- GGACCCGTCACTACAACTTC -3'

Sequencing Primer
(F):5'- CATGTTTTGCCTTCAGGC -3'
(R):5'- TTTCACAGTTTCCGTGAAAAACCC -3'

Posted On

2021-01-18