Incidental Mutation 'R8492:Ap3b1'
ID 658073
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 067934-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94531294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 91 (N91S)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022196
AA Change: N91S

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: N91S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,094,243 (GRCm39) R43K possibly damaging Het
Abcc2 A T 19: 43,793,410 (GRCm39) Y354F probably benign Het
Aloxe3 A T 11: 69,017,301 (GRCm39) T25S possibly damaging Het
Als2 T C 1: 59,250,503 (GRCm39) K414E probably damaging Het
Ankmy2 A T 12: 36,226,590 (GRCm39) I95F probably damaging Het
Ankrd35 T G 3: 96,589,529 (GRCm39) probably null Het
Apip T A 2: 102,922,866 (GRCm39) L228H probably damaging Het
Arhgap23 A G 11: 97,365,847 (GRCm39) Y488C probably damaging Het
Asah2 G A 19: 31,983,659 (GRCm39) T595M probably benign Het
Ccdc174 G C 6: 91,865,138 (GRCm39) R132T probably benign Het
Ccng2 A C 5: 93,419,313 (GRCm39) H233P probably damaging Het
Cemip A G 7: 83,622,422 (GRCm39) F586L probably damaging Het
Cenpf A G 1: 189,390,926 (GRCm39) S969P probably damaging Het
Cep170b G A 12: 112,711,134 (GRCm39) D1505N probably damaging Het
Colec12 T A 18: 9,876,980 (GRCm39) probably null Het
Cytip A G 2: 58,027,869 (GRCm39) probably null Het
D630045J12Rik A T 6: 38,167,525 (GRCm39) S1026T probably damaging Het
Disc1 T A 8: 125,817,177 (GRCm39) D372E probably damaging Het
Dlgap2 A T 8: 14,828,271 (GRCm39) M560L possibly damaging Het
Dync2li1 C A 17: 84,957,134 (GRCm39) probably null Het
Eif3c C T 7: 126,162,282 (GRCm39) G180D probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
G6pc2 A G 2: 69,050,586 (GRCm39) I70M probably damaging Het
Gm5145 A T 17: 20,790,681 (GRCm39) I20F probably damaging Het
Hba-x T A 11: 32,227,921 (GRCm39) F128L probably benign Het
Hspb1 G A 5: 135,918,222 (GRCm39) E190K possibly damaging Het
Ift122 T A 6: 115,863,966 (GRCm39) S246T probably benign Het
Inppl1 A T 7: 101,475,985 (GRCm39) S828T probably damaging Het
Krt84 C A 15: 101,438,051 (GRCm39) Q301H probably damaging Het
Malrd1 T G 2: 15,614,934 (GRCm39) S250A Het
Mettl21e A G 1: 44,245,553 (GRCm39) I231T probably damaging Het
Miip T C 4: 147,945,881 (GRCm39) D341G probably damaging Het
Ncoa1 T C 12: 4,313,473 (GRCm39) D1287G probably damaging Het
Ndufb5 T G 3: 32,805,377 (GRCm39) probably null Het
Neb T C 2: 52,203,224 (GRCm39) E309G probably damaging Het
Nf1 T A 11: 79,299,248 (GRCm39) F199I probably benign Het
Or12k7 T A 2: 36,958,695 (GRCm39) I126N probably damaging Het
Pcdhgc3 T A 18: 37,940,347 (GRCm39) Y249* probably null Het
Plekhg3 G T 12: 76,622,790 (GRCm39) V677L probably benign Het
Ppm1f T C 16: 16,733,042 (GRCm39) Y25H probably damaging Het
Prok2 A T 6: 99,691,437 (GRCm39) H75Q probably benign Het
Ralgapa2 A T 2: 146,184,524 (GRCm39) H1494Q possibly damaging Het
Rapgef6 T G 11: 54,581,063 (GRCm39) I1277S probably damaging Het
Rhob G T 12: 8,549,531 (GRCm39) Y34* probably null Het
Rnf141 T G 7: 110,436,407 (GRCm39) D7A probably benign Het
Robo1 T C 16: 72,809,911 (GRCm39) S1220P probably benign Het
Rpl13a A G 7: 44,775,945 (GRCm39) V48A possibly damaging Het
Serpinb9f C A 13: 33,518,587 (GRCm39) H362Q probably damaging Het
Shld2 T A 14: 33,967,189 (GRCm39) K122N probably damaging Het
Slc22a8 G T 19: 8,571,595 (GRCm39) V109L probably damaging Het
Slc5a10 A G 11: 61,564,809 (GRCm39) V390A probably benign Het
Snx14 T C 9: 88,263,869 (GRCm39) N839D possibly damaging Het
Taf1c G A 8: 120,325,456 (GRCm39) T802I probably benign Het
Tdh C A 14: 63,730,269 (GRCm39) D337Y probably damaging Het
Tmem156 A T 5: 65,222,438 (GRCm39) Y255N possibly damaging Het
Tmpo C A 10: 90,997,720 (GRCm39) R689L probably benign Het
Trim56 A C 5: 137,141,783 (GRCm39) C578G probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Trpv3 G A 11: 73,179,035 (GRCm39) W481* probably null Het
Tssk3 T C 4: 129,383,445 (GRCm39) M76V probably benign Het
Vmn1r215 A T 13: 23,260,056 (GRCm39) Y32F possibly damaging Het
Vmn1r53 A G 6: 90,200,394 (GRCm39) I310T possibly damaging Het
Vmn2r112 A G 17: 22,821,470 (GRCm39) T148A probably benign Het
Zdhhc14 G A 17: 5,762,689 (GRCm39) V198I probably damaging Het
Zfp109 T C 7: 23,927,499 (GRCm39) R637G possibly damaging Het
Zic5 G T 14: 122,702,474 (GRCm39) Q86K unknown Het
Zzef1 T A 11: 72,777,572 (GRCm39) M1801K probably damaging Het
Zzef1 T G 11: 72,763,430 (GRCm39) V1359G probably damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGGAGCTTGCTTTGTGAC -3'
(R):5'- GGACCCGTCACTACAACTTC -3'

Sequencing Primer
(F):5'- CATGTTTTGCCTTCAGGC -3'
(R):5'- TTTCACAGTTTCCGTGAAAAACCC -3'
Posted On 2021-01-18