Incidental Mutation 'R8492:Zic5'
ID658076
Institutional Source Beutler Lab
Gene Symbol Zic5
Ensembl Gene ENSMUSG00000041703
Gene Namezinc finger protein of the cerebellum 5
Synonymsodd-paired related, 1700049L20Rik, Opr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8492 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122456795-122465677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122465062 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 86 (Q86K)
Ref Sequence ENSEMBL: ENSMUSP00000035754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039118]
Predicted Effect unknown
Transcript: ENSMUST00000039118
AA Change: Q86K
SMART Domains Protein: ENSMUSP00000035754
Gene: ENSMUSG00000041703
AA Change: Q86K

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 116 154 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
ZnF_C2H2 390 408 2.2e2 SMART
ZnF_C2H2 417 444 2.14e0 SMART
ZnF_C2H2 450 474 8.02e-5 SMART
ZnF_C2H2 480 504 2.53e-2 SMART
ZnF_C2H2 510 534 7.49e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 2, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and reduced life spans with exencephaly, abnormal cerebral cortex and diencephalon morphology, abnormal gait and posture, and impaired growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,218,247 R43K possibly damaging Het
Abcc2 A T 19: 43,804,971 Y354F probably benign Het
Aloxe3 A T 11: 69,126,475 T25S possibly damaging Het
Als2 T C 1: 59,211,344 K414E probably damaging Het
Ankmy2 A T 12: 36,176,591 I95F probably damaging Het
Ankrd35 T G 3: 96,682,213 probably null Het
Ap3b1 A G 13: 94,394,786 N91S possibly damaging Het
Apip T A 2: 103,092,521 L228H probably damaging Het
Arhgap23 A G 11: 97,475,021 Y488C probably damaging Het
Asah2 G A 19: 32,006,259 T595M probably benign Het
Ccdc174 G C 6: 91,888,157 R132T probably benign Het
Ccng2 A C 5: 93,271,454 H233P probably damaging Het
Cemip A G 7: 83,973,214 F586L probably damaging Het
Cenpf A G 1: 189,658,729 S969P probably damaging Het
Cep170b G A 12: 112,744,700 D1505N probably damaging Het
Colec12 T A 18: 9,876,980 probably null Het
Cytip A G 2: 58,137,857 probably null Het
D630045J12Rik A T 6: 38,190,590 S1026T probably damaging Het
Disc1 T A 8: 125,090,438 D372E probably damaging Het
Dlgap2 A T 8: 14,778,271 M560L possibly damaging Het
Dync2li1 C A 17: 84,649,706 probably null Het
Eif3c C T 7: 126,563,110 G180D probably damaging Het
Fam35a T A 14: 34,245,232 K122N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
G6pc2 A G 2: 69,220,242 I70M probably damaging Het
Gm5145 A T 17: 20,570,419 I20F probably damaging Het
Hba-x T A 11: 32,277,921 F128L probably benign Het
Hspb1 G A 5: 135,889,368 E190K possibly damaging Het
Ift122 T A 6: 115,887,005 S246T probably benign Het
Inppl1 A T 7: 101,826,778 S828T probably damaging Het
Krt84 C A 15: 101,529,616 Q301H probably damaging Het
Malrd1 T G 2: 15,610,123 S250A Het
Mettl21e A G 1: 44,206,393 I231T probably damaging Het
Miip T C 4: 147,861,424 D341G probably damaging Het
Ncoa1 T C 12: 4,263,473 D1287G probably damaging Het
Ndufb5 T G 3: 32,751,228 probably null Het
Neb T C 2: 52,313,212 E309G probably damaging Het
Nf1 T A 11: 79,408,422 F199I probably benign Het
Olfr360 T A 2: 37,068,683 I126N probably damaging Het
Pcdhgc3 T A 18: 37,807,294 Y249* probably null Het
Plekhg3 G T 12: 76,576,016 V677L probably benign Het
Ppm1f T C 16: 16,915,178 Y25H probably damaging Het
Prok2 A T 6: 99,714,476 H75Q probably benign Het
Ralgapa2 A T 2: 146,342,604 H1494Q possibly damaging Het
Rapgef6 T G 11: 54,690,237 I1277S probably damaging Het
Rhob G T 12: 8,499,531 Y34* probably null Het
Rnf141 T G 7: 110,837,200 D7A probably benign Het
Robo1 T C 16: 73,013,023 S1220P probably benign Het
Rpl13a A G 7: 45,126,521 V48A possibly damaging Het
Serpinb9f C A 13: 33,334,604 H362Q probably damaging Het
Slc22a8 G T 19: 8,594,231 V109L probably damaging Het
Slc5a10 A G 11: 61,673,983 V390A probably benign Het
Snx14 T C 9: 88,381,816 N839D possibly damaging Het
Taf1c G A 8: 119,598,717 T802I probably benign Het
Tdh C A 14: 63,492,820 D337Y probably damaging Het
Tmem156 A T 5: 65,065,095 Y255N possibly damaging Het
Tmpo C A 10: 91,161,858 R689L probably benign Het
Trim56 A C 5: 137,112,929 C578G probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trpv3 G A 11: 73,288,209 W481* probably null Het
Tssk3 T C 4: 129,489,652 M76V probably benign Het
Vmn1r215 A T 13: 23,075,886 Y32F possibly damaging Het
Vmn1r53 A G 6: 90,223,412 I310T possibly damaging Het
Vmn2r112 A G 17: 22,602,489 T148A probably benign Het
Zdhhc14 G A 17: 5,712,414 V198I probably damaging Het
Zfp109 T C 7: 24,228,074 R637G possibly damaging Het
Zzef1 T G 11: 72,872,604 V1359G probably damaging Het
Zzef1 T A 11: 72,886,746 M1801K probably damaging Het
Other mutations in Zic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zic5 APN 14 122459512 missense unknown
Ezekiel UTSW 14 122465154 missense unknown
R0227:Zic5 UTSW 14 122459661 missense unknown
R0646:Zic5 UTSW 14 122463939 missense unknown
R1327:Zic5 UTSW 14 122459779 splice site probably benign
R1387:Zic5 UTSW 14 122459485 missense unknown
R1665:Zic5 UTSW 14 122459527 missense unknown
R2020:Zic5 UTSW 14 122464830 missense unknown
R2571:Zic5 UTSW 14 122459478 missense unknown
R4241:Zic5 UTSW 14 122464663 missense probably benign 0.03
R4610:Zic5 UTSW 14 122464800 missense probably damaging 0.98
R4706:Zic5 UTSW 14 122459557 missense unknown
R5496:Zic5 UTSW 14 122459343 missense unknown
R6178:Zic5 UTSW 14 122459336 missense unknown
R6189:Zic5 UTSW 14 122464974 missense unknown
R6332:Zic5 UTSW 14 122459749 missense unknown
R6485:Zic5 UTSW 14 122459640 missense unknown
R6564:Zic5 UTSW 14 122459421 missense unknown
R6677:Zic5 UTSW 14 122465154 missense unknown
R6877:Zic5 UTSW 14 122459688 missense unknown
R6977:Zic5 UTSW 14 122459548 missense unknown
R6977:Zic5 UTSW 14 122459555 small deletion probably benign
R6978:Zic5 UTSW 14 122459548 missense unknown
R6978:Zic5 UTSW 14 122459555 small deletion probably benign
R6996:Zic5 UTSW 14 122464668 missense probably benign 0.02
R7713:Zic5 UTSW 14 122464113 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTGGCCGAGATGAACATCC -3'
(R):5'- TATGACAGGCTTCCCGGTG -3'

Sequencing Primer
(F):5'- AGATGAACATCCCGGCCG -3'
(R):5'- TTCCCGGTGCTGGTCGG -3'
Posted On2021-01-18