Incidental Mutation 'R8492:Triobp'
ID 658077
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78947724-79005869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78994126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1750 (H1750Y)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109687
AA Change: H363Y

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: H363Y

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: H1704Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: H1704Y

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: H1750Y

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: H1750Y

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088
AA Change: H358Y

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,218,247 R43K possibly damaging Het
Abcc2 A T 19: 43,804,971 Y354F probably benign Het
Aloxe3 A T 11: 69,126,475 T25S possibly damaging Het
Als2 T C 1: 59,211,344 K414E probably damaging Het
Ankmy2 A T 12: 36,176,591 I95F probably damaging Het
Ankrd35 T G 3: 96,682,213 probably null Het
Ap3b1 A G 13: 94,394,786 N91S possibly damaging Het
Apip T A 2: 103,092,521 L228H probably damaging Het
Arhgap23 A G 11: 97,475,021 Y488C probably damaging Het
Asah2 G A 19: 32,006,259 T595M probably benign Het
Ccdc174 G C 6: 91,888,157 R132T probably benign Het
Ccng2 A C 5: 93,271,454 H233P probably damaging Het
Cemip A G 7: 83,973,214 F586L probably damaging Het
Cenpf A G 1: 189,658,729 S969P probably damaging Het
Cep170b G A 12: 112,744,700 D1505N probably damaging Het
Colec12 T A 18: 9,876,980 probably null Het
Cytip A G 2: 58,137,857 probably null Het
D630045J12Rik A T 6: 38,190,590 S1026T probably damaging Het
Disc1 T A 8: 125,090,438 D372E probably damaging Het
Dlgap2 A T 8: 14,778,271 M560L possibly damaging Het
Dync2li1 C A 17: 84,649,706 probably null Het
Eif3c C T 7: 126,563,110 G180D probably damaging Het
Fam35a T A 14: 34,245,232 K122N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
G6pc2 A G 2: 69,220,242 I70M probably damaging Het
Gm5145 A T 17: 20,570,419 I20F probably damaging Het
Hba-x T A 11: 32,277,921 F128L probably benign Het
Hspb1 G A 5: 135,889,368 E190K possibly damaging Het
Ift122 T A 6: 115,887,005 S246T probably benign Het
Inppl1 A T 7: 101,826,778 S828T probably damaging Het
Krt84 C A 15: 101,529,616 Q301H probably damaging Het
Malrd1 T G 2: 15,610,123 S250A Het
Mettl21e A G 1: 44,206,393 I231T probably damaging Het
Miip T C 4: 147,861,424 D341G probably damaging Het
Ncoa1 T C 12: 4,263,473 D1287G probably damaging Het
Ndufb5 T G 3: 32,751,228 probably null Het
Neb T C 2: 52,313,212 E309G probably damaging Het
Nf1 T A 11: 79,408,422 F199I probably benign Het
Olfr360 T A 2: 37,068,683 I126N probably damaging Het
Pcdhgc3 T A 18: 37,807,294 Y249* probably null Het
Plekhg3 G T 12: 76,576,016 V677L probably benign Het
Ppm1f T C 16: 16,915,178 Y25H probably damaging Het
Prok2 A T 6: 99,714,476 H75Q probably benign Het
Ralgapa2 A T 2: 146,342,604 H1494Q possibly damaging Het
Rapgef6 T G 11: 54,690,237 I1277S probably damaging Het
Rhob G T 12: 8,499,531 Y34* probably null Het
Rnf141 T G 7: 110,837,200 D7A probably benign Het
Robo1 T C 16: 73,013,023 S1220P probably benign Het
Rpl13a A G 7: 45,126,521 V48A possibly damaging Het
Serpinb9f C A 13: 33,334,604 H362Q probably damaging Het
Slc22a8 G T 19: 8,594,231 V109L probably damaging Het
Slc5a10 A G 11: 61,673,983 V390A probably benign Het
Snx14 T C 9: 88,381,816 N839D possibly damaging Het
Taf1c G A 8: 119,598,717 T802I probably benign Het
Tdh C A 14: 63,492,820 D337Y probably damaging Het
Tmem156 A T 5: 65,065,095 Y255N possibly damaging Het
Tmpo C A 10: 91,161,858 R689L probably benign Het
Trim56 A C 5: 137,112,929 C578G probably benign Het
Trpv3 G A 11: 73,288,209 W481* probably null Het
Tssk3 T C 4: 129,489,652 M76V probably benign Het
Vmn1r215 A T 13: 23,075,886 Y32F possibly damaging Het
Vmn1r53 A G 6: 90,223,412 I310T possibly damaging Het
Vmn2r112 A G 17: 22,602,489 T148A probably benign Het
Zdhhc14 G A 17: 5,712,414 V198I probably damaging Het
Zfp109 T C 7: 24,228,074 R637G possibly damaging Het
Zic5 G T 14: 122,465,062 Q86K unknown Het
Zzef1 T G 11: 72,872,604 V1359G probably damaging Het
Zzef1 T A 11: 72,886,746 M1801K probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8446:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8448:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8469:Triobp UTSW 15 78967019 missense probably benign 0.00
R8491:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8493:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAACCTGGGGAAGCTG -3'
(R):5'- AAGTGCAGACTAGTCACACGG -3'

Sequencing Primer
(F):5'- CTGGGCTTGTGGCGTATG -3'
(R):5'- CCTTGTCTGTAAAATGGGCACAG -3'
Posted On 2021-01-18