Incidental Mutation 'R8492:Ppm1f'
ID 658079
Institutional Source Beutler Lab
Gene Symbol Ppm1f
Ensembl Gene ENSMUSG00000026181
Gene Name protein phosphatase 1F (PP2C domain containing)
Synonyms 4933427B07Rik, 1110021B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 16896469-16927364 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16915178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 25 (Y25H)
Ref Sequence ENSEMBL: ENSMUSP00000156361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027373] [ENSMUST00000232247]
AlphaFold Q8CGA0
Predicted Effect probably damaging
Transcript: ENSMUST00000027373
AA Change: Y190H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181
AA Change: Y190H

DomainStartEndE-ValueType
Blast:PP2Cc 25 97 1e-16 BLAST
low complexity region 99 110 N/A INTRINSIC
PP2Cc 141 408 3.14e-79 SMART
PP2C_SIG 168 410 5.13e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232247
AA Change: Y25H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,218,247 R43K possibly damaging Het
Abcc2 A T 19: 43,804,971 Y354F probably benign Het
Aloxe3 A T 11: 69,126,475 T25S possibly damaging Het
Als2 T C 1: 59,211,344 K414E probably damaging Het
Ankmy2 A T 12: 36,176,591 I95F probably damaging Het
Ankrd35 T G 3: 96,682,213 probably null Het
Ap3b1 A G 13: 94,394,786 N91S possibly damaging Het
Apip T A 2: 103,092,521 L228H probably damaging Het
Arhgap23 A G 11: 97,475,021 Y488C probably damaging Het
Asah2 G A 19: 32,006,259 T595M probably benign Het
Ccdc174 G C 6: 91,888,157 R132T probably benign Het
Ccng2 A C 5: 93,271,454 H233P probably damaging Het
Cemip A G 7: 83,973,214 F586L probably damaging Het
Cenpf A G 1: 189,658,729 S969P probably damaging Het
Cep170b G A 12: 112,744,700 D1505N probably damaging Het
Colec12 T A 18: 9,876,980 probably null Het
Cytip A G 2: 58,137,857 probably null Het
D630045J12Rik A T 6: 38,190,590 S1026T probably damaging Het
Disc1 T A 8: 125,090,438 D372E probably damaging Het
Dlgap2 A T 8: 14,778,271 M560L possibly damaging Het
Dync2li1 C A 17: 84,649,706 probably null Het
Eif3c C T 7: 126,563,110 G180D probably damaging Het
Fam35a T A 14: 34,245,232 K122N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
G6pc2 A G 2: 69,220,242 I70M probably damaging Het
Gm5145 A T 17: 20,570,419 I20F probably damaging Het
Hba-x T A 11: 32,277,921 F128L probably benign Het
Hspb1 G A 5: 135,889,368 E190K possibly damaging Het
Ift122 T A 6: 115,887,005 S246T probably benign Het
Inppl1 A T 7: 101,826,778 S828T probably damaging Het
Krt84 C A 15: 101,529,616 Q301H probably damaging Het
Malrd1 T G 2: 15,610,123 S250A Het
Mettl21e A G 1: 44,206,393 I231T probably damaging Het
Miip T C 4: 147,861,424 D341G probably damaging Het
Ncoa1 T C 12: 4,263,473 D1287G probably damaging Het
Ndufb5 T G 3: 32,751,228 probably null Het
Neb T C 2: 52,313,212 E309G probably damaging Het
Nf1 T A 11: 79,408,422 F199I probably benign Het
Olfr360 T A 2: 37,068,683 I126N probably damaging Het
Pcdhgc3 T A 18: 37,807,294 Y249* probably null Het
Plekhg3 G T 12: 76,576,016 V677L probably benign Het
Prok2 A T 6: 99,714,476 H75Q probably benign Het
Ralgapa2 A T 2: 146,342,604 H1494Q possibly damaging Het
Rapgef6 T G 11: 54,690,237 I1277S probably damaging Het
Rhob G T 12: 8,499,531 Y34* probably null Het
Rnf141 T G 7: 110,837,200 D7A probably benign Het
Robo1 T C 16: 73,013,023 S1220P probably benign Het
Rpl13a A G 7: 45,126,521 V48A possibly damaging Het
Serpinb9f C A 13: 33,334,604 H362Q probably damaging Het
Slc22a8 G T 19: 8,594,231 V109L probably damaging Het
Slc5a10 A G 11: 61,673,983 V390A probably benign Het
Snx14 T C 9: 88,381,816 N839D possibly damaging Het
Taf1c G A 8: 119,598,717 T802I probably benign Het
Tdh C A 14: 63,492,820 D337Y probably damaging Het
Tmem156 A T 5: 65,065,095 Y255N possibly damaging Het
Tmpo C A 10: 91,161,858 R689L probably benign Het
Trim56 A C 5: 137,112,929 C578G probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trpv3 G A 11: 73,288,209 W481* probably null Het
Tssk3 T C 4: 129,489,652 M76V probably benign Het
Vmn1r215 A T 13: 23,075,886 Y32F possibly damaging Het
Vmn1r53 A G 6: 90,223,412 I310T possibly damaging Het
Vmn2r112 A G 17: 22,602,489 T148A probably benign Het
Zdhhc14 G A 17: 5,712,414 V198I probably damaging Het
Zfp109 T C 7: 24,228,074 R637G possibly damaging Het
Zic5 G T 14: 122,465,062 Q86K unknown Het
Zzef1 T G 11: 72,872,604 V1359G probably damaging Het
Zzef1 T A 11: 72,886,746 M1801K probably damaging Het
Other mutations in Ppm1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ppm1f APN 16 16923913 missense probably benign 0.03
IGL00495:Ppm1f APN 16 16910971 missense possibly damaging 0.87
IGL01024:Ppm1f APN 16 16923769 missense probably benign 0.05
IGL02076:Ppm1f APN 16 16914171 missense possibly damaging 0.93
IGL02332:Ppm1f APN 16 16914087 missense possibly damaging 0.72
IGL02422:Ppm1f APN 16 16917716 missense probably damaging 0.99
IGL02936:Ppm1f APN 16 16915236 missense probably damaging 1.00
IGL03118:Ppm1f APN 16 16914078 missense probably null 0.03
R0348:Ppm1f UTSW 16 16903390 start codon destroyed probably null 0.71
R0621:Ppm1f UTSW 16 16915308 missense probably benign 0.00
R0970:Ppm1f UTSW 16 16903593 critical splice donor site probably null
R1785:Ppm1f UTSW 16 16910970 missense probably benign
R1812:Ppm1f UTSW 16 16917787 missense probably damaging 1.00
R1988:Ppm1f UTSW 16 16923666 missense probably damaging 0.98
R2080:Ppm1f UTSW 16 16923880 missense possibly damaging 0.50
R3687:Ppm1f UTSW 16 16923883 missense probably damaging 0.96
R5456:Ppm1f UTSW 16 16923746 missense probably damaging 0.99
R7162:Ppm1f UTSW 16 16914193 missense probably damaging 1.00
R7290:Ppm1f UTSW 16 16910955 missense probably benign
R7391:Ppm1f UTSW 16 16914234 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCACTTGAGCCAGTTTGAC -3'
(R):5'- GATGCCCAAACAGCACTTTC -3'

Sequencing Primer
(F):5'- TCGTCCCCAAGTGAATTGATGAC -3'
(R):5'- TTTCAACCCAACTGCCAGCTC -3'
Posted On 2021-01-18