Mutagenetix > Incidental Mutation

Incidental Mutation 'R8492:Ppm1f'

658079

Institutional Source

Beutler Lab

Gene Symbol

Ppm1f

Ensembl Gene

ENSMUSG00000026181

Gene Name

protein phosphatase 1F (PP2C domain containing)

Synonyms

4933427B07Rik, 1110021B16Rik

MMRRC Submission

067934-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8492 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16896469-16927364 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16915178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 25 (Y25H)

Ref Sequence

ENSEMBL: ENSMUSP00000156361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027373] [ENSMUST00000232247]

AlphaFold

Q8CGA0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027373
AA Change: Y190H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181
AA Change: Y190H

Domain	Start	End	E-Value	Type
Blast:PP2Cc	25	97	1e-16	BLAST
low complexity region	99	110	N/A	INTRINSIC
PP2Cc	141	408	3.14e-79	SMART
PP2C_SIG	168	410	5.13e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000232247
AA Change: Y25H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	G	A	10: 29,218,247	R43K	possibly damaging	Het
Abcc2	A	T	19: 43,804,971	Y354F	probably benign	Het
Aloxe3	A	T	11: 69,126,475	T25S	possibly damaging	Het
Als2	T	C	1: 59,211,344	K414E	probably damaging	Het
Ankmy2	A	T	12: 36,176,591	I95F	probably damaging	Het
Ankrd35	T	G	3: 96,682,213		probably null	Het
Ap3b1	A	G	13: 94,394,786	N91S	possibly damaging	Het
Apip	T	A	2: 103,092,521	L228H	probably damaging	Het
Arhgap23	A	G	11: 97,475,021	Y488C	probably damaging	Het
Asah2	G	A	19: 32,006,259	T595M	probably benign	Het
Ccdc174	G	C	6: 91,888,157	R132T	probably benign	Het
Ccng2	A	C	5: 93,271,454	H233P	probably damaging	Het
Cemip	A	G	7: 83,973,214	F586L	probably damaging	Het
Cenpf	A	G	1: 189,658,729	S969P	probably damaging	Het
Cep170b	G	A	12: 112,744,700	D1505N	probably damaging	Het
Colec12	T	A	18: 9,876,980		probably null	Het
Cytip	A	G	2: 58,137,857		probably null	Het
D630045J12Rik	A	T	6: 38,190,590	S1026T	probably damaging	Het
Disc1	T	A	8: 125,090,438	D372E	probably damaging	Het
Dlgap2	A	T	8: 14,778,271	M560L	possibly damaging	Het
Dync2li1	C	A	17: 84,649,706		probably null	Het
Eif3c	C	T	7: 126,563,110	G180D	probably damaging	Het
Fam35a	T	A	14: 34,245,232	K122N	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
G6pc2	A	G	2: 69,220,242	I70M	probably damaging	Het
Gm5145	A	T	17: 20,570,419	I20F	probably damaging	Het
Hba-x	T	A	11: 32,277,921	F128L	probably benign	Het
Hspb1	G	A	5: 135,889,368	E190K	possibly damaging	Het
Ift122	T	A	6: 115,887,005	S246T	probably benign	Het
Inppl1	A	T	7: 101,826,778	S828T	probably damaging	Het
Krt84	C	A	15: 101,529,616	Q301H	probably damaging	Het
Malrd1	T	G	2: 15,610,123	S250A		Het
Mettl21e	A	G	1: 44,206,393	I231T	probably damaging	Het
Miip	T	C	4: 147,861,424	D341G	probably damaging	Het
Ncoa1	T	C	12: 4,263,473	D1287G	probably damaging	Het
Ndufb5	T	G	3: 32,751,228		probably null	Het
Neb	T	C	2: 52,313,212	E309G	probably damaging	Het
Nf1	T	A	11: 79,408,422	F199I	probably benign	Het
Olfr360	T	A	2: 37,068,683	I126N	probably damaging	Het
Pcdhgc3	T	A	18: 37,807,294	Y249*	probably null	Het
Plekhg3	G	T	12: 76,576,016	V677L	probably benign	Het
Prok2	A	T	6: 99,714,476	H75Q	probably benign	Het
Ralgapa2	A	T	2: 146,342,604	H1494Q	possibly damaging	Het
Rapgef6	T	G	11: 54,690,237	I1277S	probably damaging	Het
Rhob	G	T	12: 8,499,531	Y34*	probably null	Het
Rnf141	T	G	7: 110,837,200	D7A	probably benign	Het
Robo1	T	C	16: 73,013,023	S1220P	probably benign	Het
Rpl13a	A	G	7: 45,126,521	V48A	possibly damaging	Het
Serpinb9f	C	A	13: 33,334,604	H362Q	probably damaging	Het
Slc22a8	G	T	19: 8,594,231	V109L	probably damaging	Het
Slc5a10	A	G	11: 61,673,983	V390A	probably benign	Het
Snx14	T	C	9: 88,381,816	N839D	possibly damaging	Het
Taf1c	G	A	8: 119,598,717	T802I	probably benign	Het
Tdh	C	A	14: 63,492,820	D337Y	probably damaging	Het
Tmem156	A	T	5: 65,065,095	Y255N	possibly damaging	Het
Tmpo	C	A	10: 91,161,858	R689L	probably benign	Het
Trim56	A	C	5: 137,112,929	C578G	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trpv3	G	A	11: 73,288,209	W481*	probably null	Het
Tssk3	T	C	4: 129,489,652	M76V	probably benign	Het
Vmn1r215	A	T	13: 23,075,886	Y32F	possibly damaging	Het
Vmn1r53	A	G	6: 90,223,412	I310T	possibly damaging	Het
Vmn2r112	A	G	17: 22,602,489	T148A	probably benign	Het
Zdhhc14	G	A	17: 5,712,414	V198I	probably damaging	Het
Zfp109	T	C	7: 24,228,074	R637G	possibly damaging	Het
Zic5	G	T	14: 122,465,062	Q86K	unknown	Het
Zzef1	T	G	11: 72,872,604	V1359G	probably damaging	Het
Zzef1	T	A	11: 72,886,746	M1801K	probably damaging	Het

Other mutations in Ppm1f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Ppm1f	APN	16	16923913	missense	probably benign	0.03
IGL00495:Ppm1f	APN	16	16910971	missense	possibly damaging	0.87
IGL01024:Ppm1f	APN	16	16923769	missense	probably benign	0.05
IGL02076:Ppm1f	APN	16	16914171	missense	possibly damaging	0.93
IGL02332:Ppm1f	APN	16	16914087	missense	possibly damaging	0.72
IGL02422:Ppm1f	APN	16	16917716	missense	probably damaging	0.99
IGL02936:Ppm1f	APN	16	16915236	missense	probably damaging	1.00
IGL03118:Ppm1f	APN	16	16914078	missense	probably null	0.03
R0348:Ppm1f	UTSW	16	16903390	start codon destroyed	probably null	0.71
R0621:Ppm1f	UTSW	16	16915308	missense	probably benign	0.00
R0970:Ppm1f	UTSW	16	16903593	critical splice donor site	probably null
R1785:Ppm1f	UTSW	16	16910970	missense	probably benign
R1812:Ppm1f	UTSW	16	16917787	missense	probably damaging	1.00
R1988:Ppm1f	UTSW	16	16923666	missense	probably damaging	0.98
R2080:Ppm1f	UTSW	16	16923880	missense	possibly damaging	0.50
R3687:Ppm1f	UTSW	16	16923883	missense	probably damaging	0.96
R5456:Ppm1f	UTSW	16	16923746	missense	probably damaging	0.99
R7162:Ppm1f	UTSW	16	16914193	missense	probably damaging	1.00
R7290:Ppm1f	UTSW	16	16910955	missense	probably benign
R7391:Ppm1f	UTSW	16	16914234	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGCACTTGAGCCAGTTTGAC -3'
(R):5'- GATGCCCAAACAGCACTTTC -3'

Sequencing Primer
(F):5'- TCGTCCCCAAGTGAATTGATGAC -3'
(R):5'- TTTCAACCCAACTGCCAGCTC -3'

Posted On

2021-01-18