Incidental Mutation 'R8492:Asah2'
ID 658086
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 31984654-32061469 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32006259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 595 (T595M)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect probably benign
Transcript: ENSMUST00000096119
AA Change: T595M

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: T595M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,218,247 R43K possibly damaging Het
Abcc2 A T 19: 43,804,971 Y354F probably benign Het
Aloxe3 A T 11: 69,126,475 T25S possibly damaging Het
Als2 T C 1: 59,211,344 K414E probably damaging Het
Ankmy2 A T 12: 36,176,591 I95F probably damaging Het
Ankrd35 T G 3: 96,682,213 probably null Het
Ap3b1 A G 13: 94,394,786 N91S possibly damaging Het
Apip T A 2: 103,092,521 L228H probably damaging Het
Arhgap23 A G 11: 97,475,021 Y488C probably damaging Het
Ccdc174 G C 6: 91,888,157 R132T probably benign Het
Ccng2 A C 5: 93,271,454 H233P probably damaging Het
Cemip A G 7: 83,973,214 F586L probably damaging Het
Cenpf A G 1: 189,658,729 S969P probably damaging Het
Cep170b G A 12: 112,744,700 D1505N probably damaging Het
Colec12 T A 18: 9,876,980 probably null Het
Cytip A G 2: 58,137,857 probably null Het
D630045J12Rik A T 6: 38,190,590 S1026T probably damaging Het
Disc1 T A 8: 125,090,438 D372E probably damaging Het
Dlgap2 A T 8: 14,778,271 M560L possibly damaging Het
Dync2li1 C A 17: 84,649,706 probably null Het
Eif3c C T 7: 126,563,110 G180D probably damaging Het
Fam35a T A 14: 34,245,232 K122N probably damaging Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
G6pc2 A G 2: 69,220,242 I70M probably damaging Het
Gm5145 A T 17: 20,570,419 I20F probably damaging Het
Hba-x T A 11: 32,277,921 F128L probably benign Het
Hspb1 G A 5: 135,889,368 E190K possibly damaging Het
Ift122 T A 6: 115,887,005 S246T probably benign Het
Inppl1 A T 7: 101,826,778 S828T probably damaging Het
Krt84 C A 15: 101,529,616 Q301H probably damaging Het
Malrd1 T G 2: 15,610,123 S250A Het
Mettl21e A G 1: 44,206,393 I231T probably damaging Het
Miip T C 4: 147,861,424 D341G probably damaging Het
Ncoa1 T C 12: 4,263,473 D1287G probably damaging Het
Ndufb5 T G 3: 32,751,228 probably null Het
Neb T C 2: 52,313,212 E309G probably damaging Het
Nf1 T A 11: 79,408,422 F199I probably benign Het
Olfr360 T A 2: 37,068,683 I126N probably damaging Het
Pcdhgc3 T A 18: 37,807,294 Y249* probably null Het
Plekhg3 G T 12: 76,576,016 V677L probably benign Het
Ppm1f T C 16: 16,915,178 Y25H probably damaging Het
Prok2 A T 6: 99,714,476 H75Q probably benign Het
Ralgapa2 A T 2: 146,342,604 H1494Q possibly damaging Het
Rapgef6 T G 11: 54,690,237 I1277S probably damaging Het
Rhob G T 12: 8,499,531 Y34* probably null Het
Rnf141 T G 7: 110,837,200 D7A probably benign Het
Robo1 T C 16: 73,013,023 S1220P probably benign Het
Rpl13a A G 7: 45,126,521 V48A possibly damaging Het
Serpinb9f C A 13: 33,334,604 H362Q probably damaging Het
Slc22a8 G T 19: 8,594,231 V109L probably damaging Het
Slc5a10 A G 11: 61,673,983 V390A probably benign Het
Snx14 T C 9: 88,381,816 N839D possibly damaging Het
Taf1c G A 8: 119,598,717 T802I probably benign Het
Tdh C A 14: 63,492,820 D337Y probably damaging Het
Tmem156 A T 5: 65,065,095 Y255N possibly damaging Het
Tmpo C A 10: 91,161,858 R689L probably benign Het
Trim56 A C 5: 137,112,929 C578G probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Trpv3 G A 11: 73,288,209 W481* probably null Het
Tssk3 T C 4: 129,489,652 M76V probably benign Het
Vmn1r215 A T 13: 23,075,886 Y32F possibly damaging Het
Vmn1r53 A G 6: 90,223,412 I310T possibly damaging Het
Vmn2r112 A G 17: 22,602,489 T148A probably benign Het
Zdhhc14 G A 17: 5,712,414 V198I probably damaging Het
Zfp109 T C 7: 24,228,074 R637G possibly damaging Het
Zic5 G T 14: 122,465,062 Q86K unknown Het
Zzef1 T G 11: 72,872,604 V1359G probably damaging Het
Zzef1 T A 11: 72,886,746 M1801K probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2045:Asah2 UTSW 19 32052956 missense probably benign 0.01
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5081:Asah2 UTSW 19 32014308 missense probably benign 0.07
R5741:Asah2 UTSW 19 32008615 missense probably damaging 1.00
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
R8682:Asah2 UTSW 19 32052877 missense probably damaging 1.00
R8766:Asah2 UTSW 19 32057880 missense possibly damaging 0.46
R8873:Asah2 UTSW 19 32044888 critical splice donor site probably null
R8974:Asah2 UTSW 19 32052905 missense probably benign
R9088:Asah2 UTSW 19 32052960 missense probably damaging 1.00
R9405:Asah2 UTSW 19 32008645 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGTCTACTCAACTCTCTAAATAGG -3'
(R):5'- TGGTCCAGACATCACTTTGG -3'

Sequencing Primer
(F):5'- GGGATAGCATTTGCAATGTAAATG -3'
(R):5'- TGCTTTTACTGCAGGCTC -3'
Posted On 2021-01-18