Mutagenetix > Incidental Mutation

Incidental Mutation 'R8492:Asah2'

658086

Institutional Source

Beutler Lab

Gene Symbol

Asah2

Ensembl Gene

ENSMUSG00000024887

Gene Name

N-acylsphingosine amidohydrolase 2

Synonyms

neutral/alkaline ceramidase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R8492 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31984654-32061469 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 32006259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 595 (T595M)

Ref Sequence

ENSEMBL: ENSMUSP00000093830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096119]

AlphaFold

Q9JHE3

Predicted Effect

probably benign
Transcript: ENSMUST00000096119
AA Change: T595M

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: T595M

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
Pfam:Ceramidase_alk	78	584	1.4e-222	PFAM
Pfam:Ceramidse_alk_C	586	753	8e-50	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	G	A	10: 29,218,247	R43K	possibly damaging	Het
Abcc2	A	T	19: 43,804,971	Y354F	probably benign	Het
Aloxe3	A	T	11: 69,126,475	T25S	possibly damaging	Het
Als2	T	C	1: 59,211,344	K414E	probably damaging	Het
Ankmy2	A	T	12: 36,176,591	I95F	probably damaging	Het
Ankrd35	T	G	3: 96,682,213		probably null	Het
Ap3b1	A	G	13: 94,394,786	N91S	possibly damaging	Het
Apip	T	A	2: 103,092,521	L228H	probably damaging	Het
Arhgap23	A	G	11: 97,475,021	Y488C	probably damaging	Het
Ccdc174	G	C	6: 91,888,157	R132T	probably benign	Het
Ccng2	A	C	5: 93,271,454	H233P	probably damaging	Het
Cemip	A	G	7: 83,973,214	F586L	probably damaging	Het
Cenpf	A	G	1: 189,658,729	S969P	probably damaging	Het
Cep170b	G	A	12: 112,744,700	D1505N	probably damaging	Het
Colec12	T	A	18: 9,876,980		probably null	Het
Cytip	A	G	2: 58,137,857		probably null	Het
D630045J12Rik	A	T	6: 38,190,590	S1026T	probably damaging	Het
Disc1	T	A	8: 125,090,438	D372E	probably damaging	Het
Dlgap2	A	T	8: 14,778,271	M560L	possibly damaging	Het
Dync2li1	C	A	17: 84,649,706		probably null	Het
Eif3c	C	T	7: 126,563,110	G180D	probably damaging	Het
Fam35a	T	A	14: 34,245,232	K122N	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
G6pc2	A	G	2: 69,220,242	I70M	probably damaging	Het
Gm5145	A	T	17: 20,570,419	I20F	probably damaging	Het
Hba-x	T	A	11: 32,277,921	F128L	probably benign	Het
Hspb1	G	A	5: 135,889,368	E190K	possibly damaging	Het
Ift122	T	A	6: 115,887,005	S246T	probably benign	Het
Inppl1	A	T	7: 101,826,778	S828T	probably damaging	Het
Krt84	C	A	15: 101,529,616	Q301H	probably damaging	Het
Malrd1	T	G	2: 15,610,123	S250A		Het
Mettl21e	A	G	1: 44,206,393	I231T	probably damaging	Het
Miip	T	C	4: 147,861,424	D341G	probably damaging	Het
Ncoa1	T	C	12: 4,263,473	D1287G	probably damaging	Het
Ndufb5	T	G	3: 32,751,228		probably null	Het
Neb	T	C	2: 52,313,212	E309G	probably damaging	Het
Nf1	T	A	11: 79,408,422	F199I	probably benign	Het
Olfr360	T	A	2: 37,068,683	I126N	probably damaging	Het
Pcdhgc3	T	A	18: 37,807,294	Y249*	probably null	Het
Plekhg3	G	T	12: 76,576,016	V677L	probably benign	Het
Ppm1f	T	C	16: 16,915,178	Y25H	probably damaging	Het
Prok2	A	T	6: 99,714,476	H75Q	probably benign	Het
Ralgapa2	A	T	2: 146,342,604	H1494Q	possibly damaging	Het
Rapgef6	T	G	11: 54,690,237	I1277S	probably damaging	Het
Rhob	G	T	12: 8,499,531	Y34*	probably null	Het
Rnf141	T	G	7: 110,837,200	D7A	probably benign	Het
Robo1	T	C	16: 73,013,023	S1220P	probably benign	Het
Rpl13a	A	G	7: 45,126,521	V48A	possibly damaging	Het
Serpinb9f	C	A	13: 33,334,604	H362Q	probably damaging	Het
Slc22a8	G	T	19: 8,594,231	V109L	probably damaging	Het
Slc5a10	A	G	11: 61,673,983	V390A	probably benign	Het
Snx14	T	C	9: 88,381,816	N839D	possibly damaging	Het
Taf1c	G	A	8: 119,598,717	T802I	probably benign	Het
Tdh	C	A	14: 63,492,820	D337Y	probably damaging	Het
Tmem156	A	T	5: 65,065,095	Y255N	possibly damaging	Het
Tmpo	C	A	10: 91,161,858	R689L	probably benign	Het
Trim56	A	C	5: 137,112,929	C578G	probably benign	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Trpv3	G	A	11: 73,288,209	W481*	probably null	Het
Tssk3	T	C	4: 129,489,652	M76V	probably benign	Het
Vmn1r215	A	T	13: 23,075,886	Y32F	possibly damaging	Het
Vmn1r53	A	G	6: 90,223,412	I310T	possibly damaging	Het
Vmn2r112	A	G	17: 22,602,489	T148A	probably benign	Het
Zdhhc14	G	A	17: 5,712,414	V198I	probably damaging	Het
Zfp109	T	C	7: 24,228,074	R637G	possibly damaging	Het
Zic5	G	T	14: 122,465,062	Q86K	unknown	Het
Zzef1	T	G	11: 72,872,604	V1359G	probably damaging	Het
Zzef1	T	A	11: 72,886,746	M1801K	probably damaging	Het

Other mutations in Asah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01108:Asah2	APN	19	32008681	splice site	probably benign
IGL02001:Asah2	APN	19	32043539	nonsense	probably null
IGL02228:Asah2	APN	19	32016714	missense	probably benign	0.09
IGL02377:Asah2	APN	19	32009414	missense	probably benign	0.30
IGL03070:Asah2	APN	19	32006344	missense	probably damaging	1.00
IGL03233:Asah2	APN	19	32054631	missense	probably benign	0.18
IGL03244:Asah2	APN	19	31986942	missense	probably damaging	1.00
R0008:Asah2	UTSW	19	32003731	nonsense	probably null
R0103:Asah2	UTSW	19	32018977	missense	probably benign	0.01
R0103:Asah2	UTSW	19	32018977	missense	probably benign	0.01
R0302:Asah2	UTSW	19	32052956	missense	probably benign	0.01
R0497:Asah2	UTSW	19	32054631	missense	probably benign	0.18
R0614:Asah2	UTSW	19	32016728	missense	probably damaging	1.00
R0639:Asah2	UTSW	19	32008639	missense	probably damaging	0.99
R0715:Asah2	UTSW	19	32016776	missense	probably damaging	0.97
R1332:Asah2	UTSW	19	32044941	missense	probably damaging	1.00
R1336:Asah2	UTSW	19	32044941	missense	probably damaging	1.00
R2045:Asah2	UTSW	19	32052956	missense	probably benign	0.01
R2062:Asah2	UTSW	19	32024874	missense	probably damaging	0.99
R4083:Asah2	UTSW	19	31986784	missense	probably benign	0.01
R4698:Asah2	UTSW	19	32054471	splice site	probably null
R4731:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4732:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4733:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4773:Asah2	UTSW	19	32052858	missense	probably damaging	1.00
R4930:Asah2	UTSW	19	32052906	missense	probably benign	0.35
R5081:Asah2	UTSW	19	32014308	missense	probably benign	0.07
R5741:Asah2	UTSW	19	32008615	missense	probably damaging	1.00
R5873:Asah2	UTSW	19	32003682	critical splice donor site	probably null
R5905:Asah2	UTSW	19	32016514	missense	probably damaging	1.00
R6027:Asah2	UTSW	19	32044951	missense	probably benign	0.01
R6028:Asah2	UTSW	19	32016514	missense	probably damaging	1.00
R6187:Asah2	UTSW	19	32024867	missense	probably damaging	0.99
R6667:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R6968:Asah2	UTSW	19	32012513	missense	probably benign
R7010:Asah2	UTSW	19	32054554	missense	probably benign	0.00
R7404:Asah2	UTSW	19	32057854	missense	probably benign	0.13
R7575:Asah2	UTSW	19	32016703	missense	probably benign	0.11
R7797:Asah2	UTSW	19	32022361	missense	probably damaging	1.00
R8682:Asah2	UTSW	19	32052877	missense	probably damaging	1.00
R8766:Asah2	UTSW	19	32057880	missense	possibly damaging	0.46
R8873:Asah2	UTSW	19	32044888	critical splice donor site	probably null
R8974:Asah2	UTSW	19	32052905	missense	probably benign
R9088:Asah2	UTSW	19	32052960	missense	probably damaging	1.00
R9405:Asah2	UTSW	19	32008645	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGGTCTACTCAACTCTCTAAATAGG -3'
(R):5'- TGGTCCAGACATCACTTTGG -3'

Sequencing Primer
(F):5'- GGGATAGCATTTGCAATGTAAATG -3'
(R):5'- TGCTTTTACTGCAGGCTC -3'

Posted On

2021-01-18