Incidental Mutation 'R8492:Asah2'
ID 658086
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene Name N-acylsphingosine amidohydrolase 2
Synonyms neutral/alkaline ceramidase
MMRRC Submission 067934-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.448) question?
Stock # R8492 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 31962046-32080540 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31983659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 595 (T595M)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
AlphaFold Q9JHE3
Predicted Effect probably benign
Transcript: ENSMUST00000096119
AA Change: T595M

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: T595M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,094,243 (GRCm39) R43K possibly damaging Het
Abcc2 A T 19: 43,793,410 (GRCm39) Y354F probably benign Het
Aloxe3 A T 11: 69,017,301 (GRCm39) T25S possibly damaging Het
Als2 T C 1: 59,250,503 (GRCm39) K414E probably damaging Het
Ankmy2 A T 12: 36,226,590 (GRCm39) I95F probably damaging Het
Ankrd35 T G 3: 96,589,529 (GRCm39) probably null Het
Ap3b1 A G 13: 94,531,294 (GRCm39) N91S possibly damaging Het
Apip T A 2: 102,922,866 (GRCm39) L228H probably damaging Het
Arhgap23 A G 11: 97,365,847 (GRCm39) Y488C probably damaging Het
Ccdc174 G C 6: 91,865,138 (GRCm39) R132T probably benign Het
Ccng2 A C 5: 93,419,313 (GRCm39) H233P probably damaging Het
Cemip A G 7: 83,622,422 (GRCm39) F586L probably damaging Het
Cenpf A G 1: 189,390,926 (GRCm39) S969P probably damaging Het
Cep170b G A 12: 112,711,134 (GRCm39) D1505N probably damaging Het
Colec12 T A 18: 9,876,980 (GRCm39) probably null Het
Cytip A G 2: 58,027,869 (GRCm39) probably null Het
D630045J12Rik A T 6: 38,167,525 (GRCm39) S1026T probably damaging Het
Disc1 T A 8: 125,817,177 (GRCm39) D372E probably damaging Het
Dlgap2 A T 8: 14,828,271 (GRCm39) M560L possibly damaging Het
Dync2li1 C A 17: 84,957,134 (GRCm39) probably null Het
Eif3c C T 7: 126,162,282 (GRCm39) G180D probably damaging Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
G6pc2 A G 2: 69,050,586 (GRCm39) I70M probably damaging Het
Gm5145 A T 17: 20,790,681 (GRCm39) I20F probably damaging Het
Hba-x T A 11: 32,227,921 (GRCm39) F128L probably benign Het
Hspb1 G A 5: 135,918,222 (GRCm39) E190K possibly damaging Het
Ift122 T A 6: 115,863,966 (GRCm39) S246T probably benign Het
Inppl1 A T 7: 101,475,985 (GRCm39) S828T probably damaging Het
Krt84 C A 15: 101,438,051 (GRCm39) Q301H probably damaging Het
Malrd1 T G 2: 15,614,934 (GRCm39) S250A Het
Mettl21e A G 1: 44,245,553 (GRCm39) I231T probably damaging Het
Miip T C 4: 147,945,881 (GRCm39) D341G probably damaging Het
Ncoa1 T C 12: 4,313,473 (GRCm39) D1287G probably damaging Het
Ndufb5 T G 3: 32,805,377 (GRCm39) probably null Het
Neb T C 2: 52,203,224 (GRCm39) E309G probably damaging Het
Nf1 T A 11: 79,299,248 (GRCm39) F199I probably benign Het
Or12k7 T A 2: 36,958,695 (GRCm39) I126N probably damaging Het
Pcdhgc3 T A 18: 37,940,347 (GRCm39) Y249* probably null Het
Plekhg3 G T 12: 76,622,790 (GRCm39) V677L probably benign Het
Ppm1f T C 16: 16,733,042 (GRCm39) Y25H probably damaging Het
Prok2 A T 6: 99,691,437 (GRCm39) H75Q probably benign Het
Ralgapa2 A T 2: 146,184,524 (GRCm39) H1494Q possibly damaging Het
Rapgef6 T G 11: 54,581,063 (GRCm39) I1277S probably damaging Het
Rhob G T 12: 8,549,531 (GRCm39) Y34* probably null Het
Rnf141 T G 7: 110,436,407 (GRCm39) D7A probably benign Het
Robo1 T C 16: 72,809,911 (GRCm39) S1220P probably benign Het
Rpl13a A G 7: 44,775,945 (GRCm39) V48A possibly damaging Het
Serpinb9f C A 13: 33,518,587 (GRCm39) H362Q probably damaging Het
Shld2 T A 14: 33,967,189 (GRCm39) K122N probably damaging Het
Slc22a8 G T 19: 8,571,595 (GRCm39) V109L probably damaging Het
Slc5a10 A G 11: 61,564,809 (GRCm39) V390A probably benign Het
Snx14 T C 9: 88,263,869 (GRCm39) N839D possibly damaging Het
Taf1c G A 8: 120,325,456 (GRCm39) T802I probably benign Het
Tdh C A 14: 63,730,269 (GRCm39) D337Y probably damaging Het
Tmem156 A T 5: 65,222,438 (GRCm39) Y255N possibly damaging Het
Tmpo C A 10: 90,997,720 (GRCm39) R689L probably benign Het
Trim56 A C 5: 137,141,783 (GRCm39) C578G probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Trpv3 G A 11: 73,179,035 (GRCm39) W481* probably null Het
Tssk3 T C 4: 129,383,445 (GRCm39) M76V probably benign Het
Vmn1r215 A T 13: 23,260,056 (GRCm39) Y32F possibly damaging Het
Vmn1r53 A G 6: 90,200,394 (GRCm39) I310T possibly damaging Het
Vmn2r112 A G 17: 22,821,470 (GRCm39) T148A probably benign Het
Zdhhc14 G A 17: 5,762,689 (GRCm39) V198I probably damaging Het
Zfp109 T C 7: 23,927,499 (GRCm39) R637G possibly damaging Het
Zic5 G T 14: 122,702,474 (GRCm39) Q86K unknown Het
Zzef1 T A 11: 72,777,572 (GRCm39) M1801K probably damaging Het
Zzef1 T G 11: 72,763,430 (GRCm39) V1359G probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 31,986,081 (GRCm39) splice site probably benign
IGL02001:Asah2 APN 19 32,020,939 (GRCm39) nonsense probably null
IGL02228:Asah2 APN 19 31,994,114 (GRCm39) missense probably benign 0.09
IGL02377:Asah2 APN 19 31,986,814 (GRCm39) missense probably benign 0.30
IGL03070:Asah2 APN 19 31,983,744 (GRCm39) missense probably damaging 1.00
IGL03233:Asah2 APN 19 32,032,031 (GRCm39) missense probably benign 0.18
IGL03244:Asah2 APN 19 31,964,342 (GRCm39) missense probably damaging 1.00
R0008:Asah2 UTSW 19 31,981,131 (GRCm39) nonsense probably null
R0103:Asah2 UTSW 19 31,996,377 (GRCm39) missense probably benign 0.01
R0103:Asah2 UTSW 19 31,996,377 (GRCm39) missense probably benign 0.01
R0302:Asah2 UTSW 19 32,030,356 (GRCm39) missense probably benign 0.01
R0497:Asah2 UTSW 19 32,032,031 (GRCm39) missense probably benign 0.18
R0614:Asah2 UTSW 19 31,994,128 (GRCm39) missense probably damaging 1.00
R0639:Asah2 UTSW 19 31,986,039 (GRCm39) missense probably damaging 0.99
R0715:Asah2 UTSW 19 31,994,176 (GRCm39) missense probably damaging 0.97
R1332:Asah2 UTSW 19 32,022,341 (GRCm39) missense probably damaging 1.00
R1336:Asah2 UTSW 19 32,022,341 (GRCm39) missense probably damaging 1.00
R2045:Asah2 UTSW 19 32,030,356 (GRCm39) missense probably benign 0.01
R2062:Asah2 UTSW 19 32,002,274 (GRCm39) missense probably damaging 0.99
R4083:Asah2 UTSW 19 31,964,184 (GRCm39) missense probably benign 0.01
R4698:Asah2 UTSW 19 32,031,871 (GRCm39) splice site probably null
R4731:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4732:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4733:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R4773:Asah2 UTSW 19 32,030,258 (GRCm39) missense probably damaging 1.00
R4930:Asah2 UTSW 19 32,030,306 (GRCm39) missense probably benign 0.35
R5081:Asah2 UTSW 19 31,991,708 (GRCm39) missense probably benign 0.07
R5741:Asah2 UTSW 19 31,986,015 (GRCm39) missense probably damaging 1.00
R5873:Asah2 UTSW 19 31,981,082 (GRCm39) critical splice donor site probably null
R5905:Asah2 UTSW 19 31,993,914 (GRCm39) missense probably damaging 1.00
R6027:Asah2 UTSW 19 32,022,351 (GRCm39) missense probably benign 0.01
R6028:Asah2 UTSW 19 31,993,914 (GRCm39) missense probably damaging 1.00
R6187:Asah2 UTSW 19 32,002,267 (GRCm39) missense probably damaging 0.99
R6667:Asah2 UTSW 19 31,972,758 (GRCm39) missense probably benign 0.41
R6968:Asah2 UTSW 19 31,989,913 (GRCm39) missense probably benign
R7010:Asah2 UTSW 19 32,031,954 (GRCm39) missense probably benign 0.00
R7404:Asah2 UTSW 19 32,035,254 (GRCm39) missense probably benign 0.13
R7575:Asah2 UTSW 19 31,994,103 (GRCm39) missense probably benign 0.11
R7797:Asah2 UTSW 19 31,999,761 (GRCm39) missense probably damaging 1.00
R8682:Asah2 UTSW 19 32,030,277 (GRCm39) missense probably damaging 1.00
R8766:Asah2 UTSW 19 32,035,280 (GRCm39) missense possibly damaging 0.46
R8873:Asah2 UTSW 19 32,022,288 (GRCm39) critical splice donor site probably null
R8974:Asah2 UTSW 19 32,030,305 (GRCm39) missense probably benign
R9088:Asah2 UTSW 19 32,030,360 (GRCm39) missense probably damaging 1.00
R9405:Asah2 UTSW 19 31,986,045 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGTCTACTCAACTCTCTAAATAGG -3'
(R):5'- TGGTCCAGACATCACTTTGG -3'

Sequencing Primer
(F):5'- GGGATAGCATTTGCAATGTAAATG -3'
(R):5'- TGCTTTTACTGCAGGCTC -3'
Posted On 2021-01-18