Incidental Mutation 'R8493:Rab33b'
ID658103
Institutional Source Beutler Lab
Gene Symbol Rab33b
Ensembl Gene ENSMUSG00000027739
Gene NameRAB33B, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R8493 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location51483920-51496232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51484374 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 15 (S15T)
Ref Sequence ENSEMBL: ENSMUSP00000142215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054387] [ENSMUST00000192172]
Predicted Effect probably benign
Transcript: ENSMUST00000054387
AA Change: S15T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063054
Gene: ENSMUSG00000027739
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
RAB 34 202 1.94e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192172
AA Change: S15T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142215
Gene: ENSMUSG00000027739
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
Pfam:Ras 35 65 7.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTP-binding protein of the Rab GTPase family, whose members function in vesicle transport during protein secretion and endocytosis. Rab GTPases are active, membrane-associated proteins that recruit effector proteins in the GTP-bound state and inactive cytosolic proteins when in a GDP-bound state. The protein encoded by this gene is ubiquitously expressed and has been implicated in Golgi to endoplasmic reticulum cycling of Golgi enzymes. In addition, this protein regulates Golgi homeostasis and coordinates intra-Golgi retrograde trafficking. Allelic variants in this gene have been associated with Dyggve-Melchior-Clausen syndrome and Smith-McCort dysplasia 2, which are autosomal recessive spondyloepimetaphyseal dysplasias characterized by skeletal abnormalities. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 M1L unknown Het
4933402N22Rik T C 5: 11,921,522 L147P probably damaging Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 E125* probably null Het
Apob A T 12: 8,009,009 D2497V possibly damaging Het
Arap1 G A 7: 101,386,518 W87* probably null Het
Arhgef37 C T 18: 61,507,206 V261I probably benign Het
Arl4a A C 12: 40,036,473 C92G probably benign Het
Arrdc2 C T 8: 70,836,857 probably null Het
Atg16l1 A C 1: 87,778,982 T355P probably damaging Het
Card14 T G 11: 119,333,609 probably null Het
Cd109 G A 9: 78,657,519 V249I probably benign Het
Cdhr4 A G 9: 107,996,254 D395G probably damaging Het
Celsr1 C A 15: 85,938,006 M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 I277T probably benign Het
Chst4 A G 8: 110,030,463 V173A probably damaging Het
Clca4b T C 3: 144,912,150 N731D probably benign Het
Col11a2 A G 17: 34,059,962 E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 P341A probably damaging Het
Dclk3 A G 9: 111,468,147 E253G probably benign Het
Dnah2 T A 11: 69,452,978 D2829V probably damaging Het
Dnah7a T C 1: 53,472,908 N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 probably benign Het
Eprs A T 1: 185,407,174 K919* probably null Het
Esp16 A T 17: 39,539,930 K67* probably null Het
Fam169a G T 13: 97,122,859 E474D probably benign Het
Fam83h C T 15: 76,002,653 R945H probably benign Het
Flnb T A 14: 7,869,822 V195E probably damaging Het
Gm3159 T C 14: 4,398,567 I86T probably damaging Het
Gm3259 C T 5: 95,340,233 H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 S1655P probably benign Het
Gm4744 G A 6: 40,949,347 S103F Het
Ift122 T A 6: 115,910,331 I713N probably benign Het
Ilkap A G 1: 91,378,544 I105T probably damaging Het
Isl1 G T 13: 116,305,299 H133N possibly damaging Het
Jade1 T A 3: 41,604,678 L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 V195M probably benign Het
Kif3a A T 11: 53,598,800 K669* probably null Het
L3mbtl4 G A 17: 68,630,244 R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Naxe A G 3: 88,058,450 probably benign Het
Ndufs2 T C 1: 171,241,108 T51A probably benign Het
Nlrc5 T A 8: 94,523,220 L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 V27A unknown Het
Nucks1 A T 1: 131,929,735 M169L probably benign Het
Olfr1115 T A 2: 87,252,871 D311E probably benign Het
Olfr1128 T A 2: 87,544,770 Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 H155L probably damaging Het
Olfr1342 C T 4: 118,690,032 S140N probably benign Het
Olfr612 A T 7: 103,538,272 S321T probably benign Het
Olfr659 G T 7: 104,670,815 V38L probably benign Het
Pcnt C T 10: 76,403,623 probably null Het
Pdcd7 T C 9: 65,346,757 S206P probably benign Het
Pdia4 A T 6: 47,796,641 Y591* probably null Het
Plxna4 C T 6: 32,215,712 M771I probably benign Het
Ptpn13 A G 5: 103,564,165 Y1643C probably damaging Het
Ptpn13 A G 5: 103,569,805 I1906V probably benign Het
Rasip1 A T 7: 45,635,043 M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 C55Y probably damaging Het
Sel1l A T 12: 91,813,961 Y585* probably null Het
Slc40a1 A T 1: 45,911,416 F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 D716N probably damaging Het
Sp7 T A 15: 102,358,402 H323L possibly damaging Het
Sprtn A G 8: 124,903,194 S409G probably benign Het
St3gal2 T G 8: 110,962,221 L131R probably damaging Het
Tctn1 A G 5: 122,261,489 C91R probably damaging Het
Tgm1 A T 14: 55,700,297 V785E probably damaging Het
Tmem8 G T 17: 26,121,957 R678L probably damaging Het
Topaz1 G T 9: 122,750,508 V828L probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 probably null Het
Usp2 G A 9: 44,076,053 G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 D580G probably benign Het
Wbp1l G A 19: 46,652,549 R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 C497F probably damaging Het
Other mutations in Rab33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Rab33b APN 3 51484524 missense probably damaging 1.00
R0012:Rab33b UTSW 3 51484316 start gained probably benign
R0690:Rab33b UTSW 3 51493417 missense probably damaging 1.00
R1027:Rab33b UTSW 3 51484455 missense probably damaging 1.00
R3151:Rab33b UTSW 3 51493648 missense possibly damaging 0.83
R5259:Rab33b UTSW 3 51484612 unclassified probably benign
R5387:Rab33b UTSW 3 51493455 missense probably damaging 1.00
R5650:Rab33b UTSW 3 51493416 missense probably damaging 1.00
R5997:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
R6318:Rab33b UTSW 3 51493405 missense probably damaging 0.99
R6640:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
R8443:Rab33b UTSW 3 51493629 missense probably damaging 1.00
Z1177:Rab33b UTSW 3 51484334 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- ATCTTTCCAGGTACACCGC -3'
(R):5'- TCAATATCCACGGCTCGCTC -3'

Sequencing Primer
(F):5'- AGGTACACCGCACCGACTG -3'
(R):5'- TCGCTCTCGGAAGTCCAC -3'
Posted On2021-01-18