Incidental Mutation 'R8493:Olfr1342'
ID 658106
Institutional Source Beutler Lab
Gene Symbol Olfr1342
Ensembl Gene ENSMUSG00000043383
Gene Name olfactory receptor 1342
Synonyms GA_x6K02T2QD9B-18856980-18857927, MOR258-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118687486-118692756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118690032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 140 (S140N)
Ref Sequence ENSEMBL: ENSMUSP00000149966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060562] [ENSMUST00000216226]
AlphaFold Q8VFY3
Predicted Effect probably benign
Transcript: ENSMUST00000060562
AA Change: S140N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053925
Gene: ENSMUSG00000043383
AA Change: S140N

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:7tm_4 34 311 1.5e-55 PFAM
Pfam:7TM_GPCR_Srsx 38 243 1.6e-5 PFAM
Pfam:7tm_1 44 293 4.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216226
AA Change: S140N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 M1L unknown Het
4933402N22Rik T C 5: 11,921,522 L147P probably damaging Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 E125* probably null Het
Apob A T 12: 8,009,009 D2497V possibly damaging Het
Arap1 G A 7: 101,386,518 W87* probably null Het
Arhgef37 C T 18: 61,507,206 V261I probably benign Het
Arl4a A C 12: 40,036,473 C92G probably benign Het
Arrdc2 C T 8: 70,836,857 probably null Het
Atg16l1 A C 1: 87,778,982 T355P probably damaging Het
Card14 T G 11: 119,333,609 probably null Het
Cd109 G A 9: 78,657,519 V249I probably benign Het
Cdhr4 A G 9: 107,996,254 D395G probably damaging Het
Celsr1 C A 15: 85,938,006 M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 I277T probably benign Het
Chst4 A G 8: 110,030,463 V173A probably damaging Het
Clca4b T C 3: 144,912,150 N731D probably benign Het
Col11a2 A G 17: 34,059,962 E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 P341A probably damaging Het
Dclk3 A G 9: 111,468,147 E253G probably benign Het
Dnah2 T A 11: 69,452,978 D2829V probably damaging Het
Dnah7a T C 1: 53,472,908 N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 probably benign Het
Eprs A T 1: 185,407,174 K919* probably null Het
Esp16 A T 17: 39,539,930 K67* probably null Het
Fam169a G T 13: 97,122,859 E474D probably benign Het
Fam83h C T 15: 76,002,653 R945H probably benign Het
Flnb T A 14: 7,869,822 V195E probably damaging Het
Gm3159 T C 14: 4,398,567 I86T probably damaging Het
Gm3259 C T 5: 95,340,233 H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 S1655P probably benign Het
Gm4744 G A 6: 40,949,347 S103F Het
Ift122 T A 6: 115,910,331 I713N probably benign Het
Ilkap A G 1: 91,378,544 I105T probably damaging Het
Isl1 G T 13: 116,305,299 H133N possibly damaging Het
Jade1 T A 3: 41,604,678 L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 V195M probably benign Het
Kif3a A T 11: 53,598,800 K669* probably null Het
L3mbtl4 G A 17: 68,630,244 R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Naxe A G 3: 88,058,450 probably benign Het
Ndufs2 T C 1: 171,241,108 T51A probably benign Het
Nlrc5 T A 8: 94,523,220 L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 V27A unknown Het
Nucks1 A T 1: 131,929,735 M169L probably benign Het
Olfr1115 T A 2: 87,252,871 D311E probably benign Het
Olfr1128 T A 2: 87,544,770 Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 H155L probably damaging Het
Olfr612 A T 7: 103,538,272 S321T probably benign Het
Olfr659 G T 7: 104,670,815 V38L probably benign Het
Pcnt C T 10: 76,403,623 probably null Het
Pdcd7 T C 9: 65,346,757 S206P probably benign Het
Pdia4 A T 6: 47,796,641 Y591* probably null Het
Plxna4 C T 6: 32,215,712 M771I probably benign Het
Ptpn13 A G 5: 103,564,165 Y1643C probably damaging Het
Ptpn13 A G 5: 103,569,805 I1906V probably benign Het
Rab33b T A 3: 51,484,374 S15T probably benign Het
Rasip1 A T 7: 45,635,043 M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 C55Y probably damaging Het
Sel1l A T 12: 91,813,961 Y585* probably null Het
Slc40a1 A T 1: 45,911,416 F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 D716N probably damaging Het
Sp7 T A 15: 102,358,402 H323L possibly damaging Het
Sprtn A G 8: 124,903,194 S409G probably benign Het
St3gal2 T G 8: 110,962,221 L131R probably damaging Het
Tctn1 A G 5: 122,261,489 C91R probably damaging Het
Tgm1 A T 14: 55,700,297 V785E probably damaging Het
Tmem8 G T 17: 26,121,957 R678L probably damaging Het
Topaz1 G T 9: 122,750,508 V828L probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 probably null Het
Usp2 G A 9: 44,076,053 G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 D580G probably benign Het
Wbp1l G A 19: 46,652,549 R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 C497F probably damaging Het
Other mutations in Olfr1342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Olfr1342 APN 4 118689721 missense probably damaging 1.00
IGL02391:Olfr1342 APN 4 118690341 missense probably damaging 1.00
R0648:Olfr1342 UTSW 4 118690072 missense probably benign
R1565:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R1675:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R1823:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R2343:Olfr1342 UTSW 4 118690187 missense probably benign 0.30
R4618:Olfr1342 UTSW 4 118689470 utr 3 prime probably benign
R4941:Olfr1342 UTSW 4 118689892 missense possibly damaging 0.76
R5408:Olfr1342 UTSW 4 118690444 missense probably benign 0.00
R5587:Olfr1342 UTSW 4 118689870 missense probably damaging 1.00
R5895:Olfr1342 UTSW 4 118690117 missense probably damaging 0.97
R6023:Olfr1342 UTSW 4 118690074 missense probably damaging 1.00
R6307:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R6324:Olfr1342 UTSW 4 118690531 start gained probably benign
R6890:Olfr1342 UTSW 4 118689531 missense possibly damaging 0.72
R7218:Olfr1342 UTSW 4 118690018 missense probably benign
R7408:Olfr1342 UTSW 4 118689662 missense probably damaging 0.98
R7555:Olfr1342 UTSW 4 118689642 missense possibly damaging 0.94
R7749:Olfr1342 UTSW 4 118690228 missense probably damaging 1.00
R8098:Olfr1342 UTSW 4 118690209 missense possibly damaging 0.88
Z1176:Olfr1342 UTSW 4 118690272 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGTCCAAGCGGTCATTGAAGG -3'
(R):5'- CTCTTTGGTAGACATGAGTTACGTC -3'

Sequencing Primer
(F):5'- CATTGAAGGATGTGTCTGCAC -3'
(R):5'- GGTAGACATGAGTTACGTCACTACC -3'
Posted On 2021-01-18