Incidental Mutation 'R8493:Arap1'
ID658119
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
SynonymsCentd2, 2410002L19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8493 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location101348067-101412586 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 101386518 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 87 (W87*)
Ref Sequence ENSEMBL: ENSMUSP00000115107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000107010] [ENSMUST00000127873] [ENSMUST00000130016] [ENSMUST00000134143] [ENSMUST00000141083] [ENSMUST00000148902]
Predicted Effect probably null
Transcript: ENSMUST00000084895
AA Change: W87*
SMART Domains Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: W87*

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
PH 82 175 2.62e-17 SMART
PH 195 285 3.6e-6 SMART
ArfGap 289 415 2.4e-22 SMART
PH 498 606 1.23e-13 SMART
PH 616 710 1.08e0 SMART
RhoGAP 722 904 1.35e-63 SMART
Pfam:RA 926 1015 1.5e-10 PFAM
PH 1029 1141 8.58e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084896
AA Change: W335*
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: W335*

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107010
AA Change: W335*
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: W335*

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127873
AA Change: W73*
SMART Domains Protein: ENSMUSP00000121257
Gene: ENSMUSG00000032812
AA Change: W73*

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130016
SMART Domains Protein: ENSMUSP00000115850
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134143
AA Change: W87*
SMART Domains Protein: ENSMUSP00000115107
Gene: ENSMUSG00000032812
AA Change: W87*

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
SCOP:d1ki1b2 68 111 4e-4 SMART
Blast:PH 82 111 6e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141083
Predicted Effect probably benign
Transcript: ENSMUST00000148902
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 M1L unknown Het
4933402N22Rik T C 5: 11,921,522 L147P probably damaging Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 E125* probably null Het
Apob A T 12: 8,009,009 D2497V possibly damaging Het
Arhgef37 C T 18: 61,507,206 V261I probably benign Het
Arl4a A C 12: 40,036,473 C92G probably benign Het
Arrdc2 C T 8: 70,836,857 probably null Het
Atg16l1 A C 1: 87,778,982 T355P probably damaging Het
Card14 T G 11: 119,333,609 probably null Het
Cd109 G A 9: 78,657,519 V249I probably benign Het
Cdhr4 A G 9: 107,996,254 D395G probably damaging Het
Celsr1 C A 15: 85,938,006 M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 I277T probably benign Het
Chst4 A G 8: 110,030,463 V173A probably damaging Het
Clca4b T C 3: 144,912,150 N731D probably benign Het
Col11a2 A G 17: 34,059,962 E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 P341A probably damaging Het
Dclk3 A G 9: 111,468,147 E253G probably benign Het
Dnah2 T A 11: 69,452,978 D2829V probably damaging Het
Dnah7a T C 1: 53,472,908 N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 probably benign Het
Eprs A T 1: 185,407,174 K919* probably null Het
Esp16 A T 17: 39,539,930 K67* probably null Het
Fam169a G T 13: 97,122,859 E474D probably benign Het
Fam83h C T 15: 76,002,653 R945H probably benign Het
Flnb T A 14: 7,869,822 V195E probably damaging Het
Gm3159 T C 14: 4,398,567 I86T probably damaging Het
Gm3259 C T 5: 95,340,233 H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 S1655P probably benign Het
Gm4744 G A 6: 40,949,347 S103F Het
Ift122 T A 6: 115,910,331 I713N probably benign Het
Ilkap A G 1: 91,378,544 I105T probably damaging Het
Isl1 G T 13: 116,305,299 H133N possibly damaging Het
Jade1 T A 3: 41,604,678 L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 V195M probably benign Het
Kif3a A T 11: 53,598,800 K669* probably null Het
L3mbtl4 G A 17: 68,630,244 R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Naxe A G 3: 88,058,450 probably benign Het
Ndufs2 T C 1: 171,241,108 T51A probably benign Het
Nlrc5 T A 8: 94,523,220 L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 V27A unknown Het
Nucks1 A T 1: 131,929,735 M169L probably benign Het
Olfr1115 T A 2: 87,252,871 D311E probably benign Het
Olfr1128 T A 2: 87,544,770 Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 H155L probably damaging Het
Olfr1342 C T 4: 118,690,032 S140N probably benign Het
Olfr612 A T 7: 103,538,272 S321T probably benign Het
Olfr659 G T 7: 104,670,815 V38L probably benign Het
Pcnt C T 10: 76,403,623 probably null Het
Pdcd7 T C 9: 65,346,757 S206P probably benign Het
Pdia4 A T 6: 47,796,641 Y591* probably null Het
Plxna4 C T 6: 32,215,712 M771I probably benign Het
Ptpn13 A G 5: 103,564,165 Y1643C probably damaging Het
Ptpn13 A G 5: 103,569,805 I1906V probably benign Het
Rab33b T A 3: 51,484,374 S15T probably benign Het
Rasip1 A T 7: 45,635,043 M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 C55Y probably damaging Het
Sel1l A T 12: 91,813,961 Y585* probably null Het
Slc40a1 A T 1: 45,911,416 F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 D716N probably damaging Het
Sp7 T A 15: 102,358,402 H323L possibly damaging Het
Sprtn A G 8: 124,903,194 S409G probably benign Het
St3gal2 T G 8: 110,962,221 L131R probably damaging Het
Tctn1 A G 5: 122,261,489 C91R probably damaging Het
Tgm1 A T 14: 55,700,297 V785E probably damaging Het
Tmem8 G T 17: 26,121,957 R678L probably damaging Het
Topaz1 G T 9: 122,750,508 V828L probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 probably null Het
Usp2 G A 9: 44,076,053 G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 D580G probably benign Het
Wbp1l G A 19: 46,652,549 R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 C497F probably damaging Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101388049 missense probably damaging 0.96
IGL01311:Arap1 APN 7 101388136 nonsense probably null
IGL01349:Arap1 APN 7 101387152 missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101400605 critical splice donor site probably null
IGL01869:Arap1 APN 7 101400283 missense probably damaging 1.00
IGL02156:Arap1 APN 7 101388730 unclassified probably benign
IGL02320:Arap1 APN 7 101385029 missense probably benign
IGL02478:Arap1 APN 7 101400125 splice site probably null
R0133:Arap1 UTSW 7 101386229 missense probably damaging 0.98
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101390222 missense probably damaging 0.98
R0616:Arap1 UTSW 7 101401650 missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101400412 missense probably damaging 1.00
R0962:Arap1 UTSW 7 101384914 missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101404269 splice site probably benign
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1724:Arap1 UTSW 7 101400526 missense possibly damaging 0.91
R1793:Arap1 UTSW 7 101388622 missense probably benign
R1959:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R1960:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R2020:Arap1 UTSW 7 101401518 missense probably benign 0.00
R2128:Arap1 UTSW 7 101409320 missense probably damaging 1.00
R3737:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101390165 nonsense probably null
R4034:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R4386:Arap1 UTSW 7 101385571 missense probably benign
R4435:Arap1 UTSW 7 101390254 missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101404367 missense probably damaging 1.00
R4786:Arap1 UTSW 7 101385005 missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101398791 missense probably damaging 1.00
R4942:Arap1 UTSW 7 101401802 missense possibly damaging 0.95
R5253:Arap1 UTSW 7 101388644 missense probably benign 0.00
R5342:Arap1 UTSW 7 101404960 missense probably benign 0.00
R5367:Arap1 UTSW 7 101409130 missense probably damaging 0.99
R5397:Arap1 UTSW 7 101384912 missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101394738 missense probably damaging 1.00
R6052:Arap1 UTSW 7 101404033 missense probably damaging 1.00
R6574:Arap1 UTSW 7 101404001 missense probably damaging 1.00
R6645:Arap1 UTSW 7 101408111 missense possibly damaging 0.57
R7060:Arap1 UTSW 7 101409357 splice site probably null
R7191:Arap1 UTSW 7 101384992 missense probably benign 0.31
R7323:Arap1 UTSW 7 101400211 missense probably damaging 1.00
R7349:Arap1 UTSW 7 101390228 missense possibly damaging 0.95
R7516:Arap1 UTSW 7 101409331 missense probably benign 0.00
R7922:Arap1 UTSW 7 101404414 nonsense probably null
R8034:Arap1 UTSW 7 101394773 missense probably damaging 1.00
R8293:Arap1 UTSW 7 101400934 missense probably benign
R8810:Arap1 UTSW 7 101404378 missense probably damaging 0.99
R8811:Arap1 UTSW 7 101387196 missense probably damaging 1.00
R8930:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
R8931:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
R8941:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CACTCAGTTGCCTAAAGCCC -3'
(R):5'- CAGTGGTTACCAATGGTTACAGTG -3'

Sequencing Primer
(F):5'- GTTGCCTAAAGCCCAACCTAG -3'
(R):5'- ACCAATGGTTACAGTGTGTGG -3'
Posted On2021-01-18