Incidental Mutation 'R8493:Gvin2'
ID 658122
Institutional Source Beutler Lab
Gene Symbol Gvin2
Ensembl Gene ENSMUSG00000078606
Gene Name GTPase, very large interferon inducible, family member 2
Synonyms Gm4070
MMRRC Submission 067935-MU
Accession Numbers
Essential gene? Not available question?
Stock # R8493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 105544346-105603174 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105548088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1655 (S1655P)
Ref Sequence ENSEMBL: ENSMUSP00000135898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106766] [ENSMUST00000176467] [ENSMUST00000176994]
AlphaFold Q80SU7
Predicted Effect probably benign
Transcript: ENSMUST00000106766
AA Change: S1655P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102377
Gene: ENSMUSG00000078606
AA Change: S1655P

DomainStartEndE-ValueType
low complexity region 104 116 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Blast:PGAM 860 1554 7e-61 BLAST
coiled coil region 1625 1656 N/A INTRINSIC
low complexity region 1769 1781 N/A INTRINSIC
coiled coil region 1851 1877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176467
AA Change: S1655P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135898
Gene: ENSMUSG00000078606
AA Change: S1655P

DomainStartEndE-ValueType
low complexity region 104 116 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Blast:PGAM 860 1554 7e-61 BLAST
coiled coil region 1625 1656 N/A INTRINSIC
low complexity region 1769 1781 N/A INTRINSIC
coiled coil region 1851 1877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176994
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,653,453 (GRCm39) M1L unknown Het
Abca13 T A 11: 9,460,668 (GRCm39) I4226N probably damaging Het
Ankrd10 C A 8: 11,678,518 (GRCm39) E125* probably null Het
Apob A T 12: 8,059,009 (GRCm39) D2497V possibly damaging Het
Arap1 G A 7: 101,035,725 (GRCm39) W87* probably null Het
Arhgef37 C T 18: 61,640,277 (GRCm39) V261I probably benign Het
Arl4a A C 12: 40,086,472 (GRCm39) C92G probably benign Het
Arrdc2 C T 8: 71,289,501 (GRCm39) probably null Het
Atg16l1 A C 1: 87,706,704 (GRCm39) T355P probably damaging Het
Card14 T G 11: 119,224,435 (GRCm39) probably null Het
Cd109 G A 9: 78,564,801 (GRCm39) V249I probably benign Het
Cdhr4 A G 9: 107,873,453 (GRCm39) D395G probably damaging Het
Celsr1 C A 15: 85,822,207 (GRCm39) M1703I possibly damaging Het
Cfap157 A G 2: 32,669,752 (GRCm39) I277T probably benign Het
Chst4 A G 8: 110,757,095 (GRCm39) V173A probably damaging Het
Clca4b T C 3: 144,617,911 (GRCm39) N731D probably benign Het
Col11a2 A G 17: 34,278,936 (GRCm39) E1122G possibly damaging Het
Csf1r C G 18: 61,247,954 (GRCm39) P341A probably damaging Het
Dclk3 A G 9: 111,297,215 (GRCm39) E253G probably benign Het
Dnah2 T A 11: 69,343,804 (GRCm39) D2829V probably damaging Het
Dnah7a T C 1: 53,512,067 (GRCm39) N2998S probably damaging Het
Ehbp1 C T 11: 22,235,842 (GRCm39) probably benign Het
Eprs1 A T 1: 185,139,371 (GRCm39) K919* probably null Het
Esp16 A T 17: 39,850,821 (GRCm39) K67* probably null Het
Fam169a G T 13: 97,259,367 (GRCm39) E474D probably benign Het
Fam83h C T 15: 75,874,502 (GRCm39) R945H probably benign Het
Flnb T A 14: 7,869,822 (GRCm38) V195E probably damaging Het
Gm3159 T C 14: 4,398,567 (GRCm38) I86T probably damaging Het
Gm4744 G A 6: 40,926,281 (GRCm39) S103F Het
Ift122 T A 6: 115,887,292 (GRCm39) I713N probably benign Het
Ilkap A G 1: 91,306,266 (GRCm39) I105T probably damaging Het
Isl1 G T 13: 116,441,835 (GRCm39) H133N possibly damaging Het
Jade1 T A 3: 41,559,113 (GRCm39) L398Q possibly damaging Het
Kcnh7 C T 2: 62,681,003 (GRCm39) V195M probably benign Het
Kif3a A T 11: 53,489,627 (GRCm39) K669* probably null Het
L3mbtl4 G A 17: 68,937,239 (GRCm39) R420H probably damaging Het
Mrgprb1 A T 7: 48,097,321 (GRCm39) I197N probably damaging Het
Mthfd1 A G 12: 76,340,929 (GRCm39) T263A probably damaging Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Naxe A G 3: 87,965,757 (GRCm39) probably benign Het
Ndufs2 T C 1: 171,068,677 (GRCm39) T51A probably benign Het
Nlrc5 T A 8: 95,249,848 (GRCm39) L1824Q probably damaging Het
Notch1 A G 2: 26,362,251 (GRCm39) V27A unknown Het
Nucks1 A T 1: 131,857,473 (GRCm39) M169L probably benign Het
Or10ag53 T A 2: 87,083,215 (GRCm39) D311E probably benign Het
Or13p4 C T 4: 118,547,229 (GRCm39) S140N probably benign Het
Or4a80 T A 2: 89,582,599 (GRCm39) Y191F probably benign Het
Or4k45 T A 2: 111,395,324 (GRCm39) H155L probably damaging Het
Or51aa2 A T 7: 103,187,479 (GRCm39) S321T probably benign Het
Or52n20 G T 7: 104,320,022 (GRCm39) V38L probably benign Het
Or5w10 T A 2: 87,375,114 (GRCm39) Y258F probably damaging Het
Pcnt C T 10: 76,239,457 (GRCm39) probably null Het
Pdcd7 T C 9: 65,254,039 (GRCm39) S206P probably benign Het
Pdia4 A T 6: 47,773,575 (GRCm39) Y591* probably null Het
Pgap6 G T 17: 26,340,931 (GRCm39) R678L probably damaging Het
Plxna4 C T 6: 32,192,647 (GRCm39) M771I probably benign Het
Pramel47 C T 5: 95,488,092 (GRCm39) H9Y possibly damaging Het
Ptpn13 A G 5: 103,712,031 (GRCm39) Y1643C probably damaging Het
Ptpn13 A G 5: 103,717,671 (GRCm39) I1906V probably benign Het
Rab33b T A 3: 51,391,795 (GRCm39) S15T probably benign Het
Rasip1 A T 7: 45,284,467 (GRCm39) M644L possibly damaging Het
Rnf4 G A 5: 34,506,035 (GRCm39) C55Y probably damaging Het
Sel1l A T 12: 91,780,735 (GRCm39) Y585* probably null Het
Slc40a1 A T 1: 45,950,576 (GRCm39) F292Y probably damaging Het
Smarca4 G A 9: 21,570,144 (GRCm39) D716N probably damaging Het
Sp7 T A 15: 102,266,837 (GRCm39) H323L possibly damaging Het
Speer1m T C 5: 11,971,489 (GRCm39) L147P probably damaging Het
Sprtn A G 8: 125,629,933 (GRCm39) S409G probably benign Het
St3gal2 T G 8: 111,688,853 (GRCm39) L131R probably damaging Het
Tctn1 A G 5: 122,399,552 (GRCm39) C91R probably damaging Het
Tgm1 A T 14: 55,937,754 (GRCm39) V785E probably damaging Het
Topaz1 G T 9: 122,579,573 (GRCm39) V828L probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Ttc27 G A 17: 75,050,047 (GRCm39) probably null Het
Usp2 G A 9: 43,987,350 (GRCm39) G216D possibly damaging Het
Vmn2r99 A G 17: 19,614,020 (GRCm39) D580G probably benign Het
Wbp1l G A 19: 46,640,988 (GRCm39) R106H possibly damaging Het
Zmym2 G T 14: 57,151,606 (GRCm39) C497F probably damaging Het
Other mutations in Gvin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Gvin2 APN 7 105,546,009 (GRCm39) missense possibly damaging 0.52
IGL02657:Gvin2 APN 7 105,545,972 (GRCm39) missense probably damaging 1.00
R0755:Gvin2 UTSW 7 105,545,892 (GRCm39) missense possibly damaging 0.81
R6913:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R6914:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R6921:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R6941:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R6943:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R6944:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R6945:Gvin2 UTSW 7 105,551,187 (GRCm39) nonsense probably null
R7208:Gvin2 UTSW 7 105,551,386 (GRCm39) missense possibly damaging 0.58
R7400:Gvin2 UTSW 7 105,551,247 (GRCm39) missense probably benign
R8477:Gvin2 UTSW 7 105,548,133 (GRCm39) missense possibly damaging 0.66
R8880:Gvin2 UTSW 7 105,551,120 (GRCm39) missense probably benign 0.00
R9176:Gvin2 UTSW 7 105,551,262 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGGCTTTCCACAAATCTTGAAC -3'
(R):5'- ATCCCTCAGACATTCAGGACATTC -3'

Sequencing Primer
(F):5'- CCACAAATCTTGAACTCTGAATTTG -3'
(R):5'- TCAGGACATTCTACAAATATCTGTTC -3'
Posted On 2021-01-18