Incidental Mutation 'R8493:Dnah2'
ID 658141
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 067935-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69420809-69549110 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69452978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 2829 (D2829V)
Ref Sequence ENSEMBL: ENSMUSP00000047329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035539
AA Change: D2829V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: D2829V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108659
AA Change: D2835V

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: D2835V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 (GRCm38) M1L unknown Het
4933402N22Rik T C 5: 11,921,522 (GRCm38) L147P probably damaging Het
Abca13 T A 11: 9,510,668 (GRCm38) I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 (GRCm38) E125* probably null Het
Apob A T 12: 8,009,009 (GRCm38) D2497V possibly damaging Het
Arap1 G A 7: 101,386,518 (GRCm38) W87* probably null Het
Arhgef37 C T 18: 61,507,206 (GRCm38) V261I probably benign Het
Arl4a A C 12: 40,036,473 (GRCm38) C92G probably benign Het
Arrdc2 C T 8: 70,836,857 (GRCm38) probably null Het
Atg16l1 A C 1: 87,778,982 (GRCm38) T355P probably damaging Het
Card14 T G 11: 119,333,609 (GRCm38) probably null Het
Cd109 G A 9: 78,657,519 (GRCm38) V249I probably benign Het
Cdhr4 A G 9: 107,996,254 (GRCm38) D395G probably damaging Het
Celsr1 C A 15: 85,938,006 (GRCm38) M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 (GRCm38) I277T probably benign Het
Chst4 A G 8: 110,030,463 (GRCm38) V173A probably damaging Het
Clca4b T C 3: 144,912,150 (GRCm38) N731D probably benign Het
Col11a2 A G 17: 34,059,962 (GRCm38) E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 (GRCm38) P341A probably damaging Het
Dclk3 A G 9: 111,468,147 (GRCm38) E253G probably benign Het
Dnah7a T C 1: 53,472,908 (GRCm38) N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 (GRCm38) probably benign Het
Eprs A T 1: 185,407,174 (GRCm38) K919* probably null Het
Esp16 A T 17: 39,539,930 (GRCm38) K67* probably null Het
Fam169a G T 13: 97,122,859 (GRCm38) E474D probably benign Het
Fam83h C T 15: 76,002,653 (GRCm38) R945H probably benign Het
Flnb T A 14: 7,869,822 (GRCm38) V195E probably damaging Het
Gm3159 T C 14: 4,398,567 (GRCm38) I86T probably damaging Het
Gm3259 C T 5: 95,340,233 (GRCm38) H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 (GRCm38) S1655P probably benign Het
Gm4744 G A 6: 40,949,347 (GRCm38) S103F Het
Ift122 T A 6: 115,910,331 (GRCm38) I713N probably benign Het
Ilkap A G 1: 91,378,544 (GRCm38) I105T probably damaging Het
Isl1 G T 13: 116,305,299 (GRCm38) H133N possibly damaging Het
Jade1 T A 3: 41,604,678 (GRCm38) L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 (GRCm38) V195M probably benign Het
Kif3a A T 11: 53,598,800 (GRCm38) K669* probably null Het
L3mbtl4 G A 17: 68,630,244 (GRCm38) R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 (GRCm38) I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 (GRCm38) T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 (GRCm38) A62V possibly damaging Het
Naxe A G 3: 88,058,450 (GRCm38) probably benign Het
Ndufs2 T C 1: 171,241,108 (GRCm38) T51A probably benign Het
Nlrc5 T A 8: 94,523,220 (GRCm38) L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 (GRCm38) V27A unknown Het
Nucks1 A T 1: 131,929,735 (GRCm38) M169L probably benign Het
Olfr1115 T A 2: 87,252,871 (GRCm38) D311E probably benign Het
Olfr1128 T A 2: 87,544,770 (GRCm38) Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 (GRCm38) Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 (GRCm38) H155L probably damaging Het
Olfr1342 C T 4: 118,690,032 (GRCm38) S140N probably benign Het
Olfr612 A T 7: 103,538,272 (GRCm38) S321T probably benign Het
Olfr659 G T 7: 104,670,815 (GRCm38) V38L probably benign Het
Pcnt C T 10: 76,403,623 (GRCm38) probably null Het
Pdcd7 T C 9: 65,346,757 (GRCm38) S206P probably benign Het
Pdia4 A T 6: 47,796,641 (GRCm38) Y591* probably null Het
Plxna4 C T 6: 32,215,712 (GRCm38) M771I probably benign Het
Ptpn13 A G 5: 103,569,805 (GRCm38) I1906V probably benign Het
Ptpn13 A G 5: 103,564,165 (GRCm38) Y1643C probably damaging Het
Rab33b T A 3: 51,484,374 (GRCm38) S15T probably benign Het
Rasip1 A T 7: 45,635,043 (GRCm38) M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 (GRCm38) C55Y probably damaging Het
Sel1l A T 12: 91,813,961 (GRCm38) Y585* probably null Het
Slc40a1 A T 1: 45,911,416 (GRCm38) F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 (GRCm38) D716N probably damaging Het
Sp7 T A 15: 102,358,402 (GRCm38) H323L possibly damaging Het
Sprtn A G 8: 124,903,194 (GRCm38) S409G probably benign Het
St3gal2 T G 8: 110,962,221 (GRCm38) L131R probably damaging Het
Tctn1 A G 5: 122,261,489 (GRCm38) C91R probably damaging Het
Tgm1 A T 14: 55,700,297 (GRCm38) V785E probably damaging Het
Tmem8 G T 17: 26,121,957 (GRCm38) R678L probably damaging Het
Topaz1 G T 9: 122,750,508 (GRCm38) V828L probably benign Het
Triobp C T 15: 78,994,126 (GRCm38) H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 (GRCm38) probably null Het
Usp2 G A 9: 44,076,053 (GRCm38) G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 (GRCm38) D580G probably benign Het
Wbp1l G A 19: 46,652,549 (GRCm38) R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 (GRCm38) C497F probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,492,672 (GRCm38) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,495,066 (GRCm38) splice site probably benign
IGL00772:Dnah2 APN 11 69,451,257 (GRCm38) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,473,350 (GRCm38) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,448,457 (GRCm38) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,478,092 (GRCm38) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,493,184 (GRCm38) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,475,606 (GRCm38) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,432,964 (GRCm38) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,474,191 (GRCm38) splice site probably benign
IGL01480:Dnah2 APN 11 69,458,371 (GRCm38) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,516,080 (GRCm38) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,431,087 (GRCm38) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,465,063 (GRCm38) splice site probably benign
IGL01667:Dnah2 APN 11 69,544,395 (GRCm38) missense probably benign
IGL01667:Dnah2 APN 11 69,520,941 (GRCm38) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,539,443 (GRCm38) missense probably benign
IGL02019:Dnah2 APN 11 69,474,285 (GRCm38) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,499,212 (GRCm38) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,422,559 (GRCm38) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,458,185 (GRCm38) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,458,123 (GRCm38) missense probably benign
IGL02381:Dnah2 APN 11 69,446,292 (GRCm38) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,452,933 (GRCm38) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,448,507 (GRCm38) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,518,414 (GRCm38) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,521,187 (GRCm38) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,436,291 (GRCm38) splice site probably benign
IGL03120:Dnah2 APN 11 69,421,848 (GRCm38) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,458,488 (GRCm38) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,459,263 (GRCm38) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,529,381 (GRCm38) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,495,123 (GRCm38) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,496,577 (GRCm38) missense probably benign 0.13
argyrios UTSW 11 69,516,590 (GRCm38) missense possibly damaging 0.47
Aureus UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
platinum UTSW 11 69,458,042 (GRCm38) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,436,836 (GRCm38) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,430,835 (GRCm38) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,430,835 (GRCm38) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,515,615 (GRCm38) splice site probably null
P0026:Dnah2 UTSW 11 69,464,947 (GRCm38) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,421,009 (GRCm38) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,435,249 (GRCm38) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,436,836 (GRCm38) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,529,531 (GRCm38) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,447,861 (GRCm38) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,499,238 (GRCm38) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,452,879 (GRCm38) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,459,288 (GRCm38) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,448,542 (GRCm38) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,459,201 (GRCm38) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,423,126 (GRCm38) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,499,194 (GRCm38) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,477,683 (GRCm38) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,421,308 (GRCm38) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,448,519 (GRCm38) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,447,819 (GRCm38) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,446,648 (GRCm38) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,499,190 (GRCm38) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,515,700 (GRCm38) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,451,050 (GRCm38) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,520,667 (GRCm38) splice site probably null
R1538:Dnah2 UTSW 11 69,477,202 (GRCm38) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,514,688 (GRCm38) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,514,688 (GRCm38) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,521,198 (GRCm38) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,422,754 (GRCm38) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,473,854 (GRCm38) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,514,691 (GRCm38) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,497,889 (GRCm38) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,423,543 (GRCm38) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,475,574 (GRCm38) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,514,804 (GRCm38) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,437,886 (GRCm38) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,515,752 (GRCm38) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,464,930 (GRCm38) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,474,325 (GRCm38) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,458,358 (GRCm38) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,437,070 (GRCm38) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,437,070 (GRCm38) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,524,240 (GRCm38) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,496,606 (GRCm38) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,455,916 (GRCm38) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,493,237 (GRCm38) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,458,185 (GRCm38) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,458,185 (GRCm38) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,437,221 (GRCm38) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,524,206 (GRCm38) nonsense probably null
R2517:Dnah2 UTSW 11 69,516,644 (GRCm38) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,430,478 (GRCm38) missense probably benign
R3741:Dnah2 UTSW 11 69,448,469 (GRCm38) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,492,650 (GRCm38) splice site probably null
R3872:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,451,347 (GRCm38) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,454,103 (GRCm38) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,484,021 (GRCm38) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,477,659 (GRCm38) missense probably benign
R4515:Dnah2 UTSW 11 69,465,631 (GRCm38) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,483,367 (GRCm38) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,463,661 (GRCm38) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,465,376 (GRCm38) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,496,559 (GRCm38) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,458,942 (GRCm38) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,498,532 (GRCm38) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,478,077 (GRCm38) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,516,590 (GRCm38) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,476,688 (GRCm38) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,429,357 (GRCm38) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,458,042 (GRCm38) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,473,871 (GRCm38) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,423,205 (GRCm38) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,422,590 (GRCm38) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,463,648 (GRCm38) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,476,691 (GRCm38) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,521,147 (GRCm38) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,499,104 (GRCm38) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,539,496 (GRCm38) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,455,973 (GRCm38) nonsense probably null
R5015:Dnah2 UTSW 11 69,497,882 (GRCm38) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,448,166 (GRCm38) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,520,773 (GRCm38) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,520,933 (GRCm38) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,422,536 (GRCm38) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,435,884 (GRCm38) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,529,469 (GRCm38) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,457,993 (GRCm38) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,516,036 (GRCm38) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,421,848 (GRCm38) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,500,857 (GRCm38) missense probably benign
R5421:Dnah2 UTSW 11 69,435,636 (GRCm38) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,524,383 (GRCm38) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,473,351 (GRCm38) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,437,188 (GRCm38) nonsense probably null
R5566:Dnah2 UTSW 11 69,516,569 (GRCm38) nonsense probably null
R5587:Dnah2 UTSW 11 69,437,242 (GRCm38) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,491,544 (GRCm38) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,435,390 (GRCm38) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,430,817 (GRCm38) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,448,430 (GRCm38) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,431,148 (GRCm38) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,520,881 (GRCm38) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,500,839 (GRCm38) missense probably benign
R6036:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,516,008 (GRCm38) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,446,649 (GRCm38) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,518,359 (GRCm38) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,458,542 (GRCm38) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,520,903 (GRCm38) nonsense probably null
R6171:Dnah2 UTSW 11 69,423,042 (GRCm38) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,457,412 (GRCm38) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,491,641 (GRCm38) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,448,227 (GRCm38) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,458,518 (GRCm38) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,539,415 (GRCm38) missense probably benign
R6478:Dnah2 UTSW 11 69,516,010 (GRCm38) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,465,386 (GRCm38) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,437,197 (GRCm38) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,423,690 (GRCm38) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,455,963 (GRCm38) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,429,471 (GRCm38) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,484,260 (GRCm38) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,421,741 (GRCm38) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,491,547 (GRCm38) nonsense probably null
R7073:Dnah2 UTSW 11 69,430,492 (GRCm38) nonsense probably null
R7111:Dnah2 UTSW 11 69,446,753 (GRCm38) splice site probably null
R7125:Dnah2 UTSW 11 69,436,182 (GRCm38) missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69,491,555 (GRCm38) missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69,549,097 (GRCm38) splice site probably null
R7214:Dnah2 UTSW 11 69,431,109 (GRCm38) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,421,396 (GRCm38) missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69,459,146 (GRCm38) critical splice donor site probably null
R7256:Dnah2 UTSW 11 69,431,094 (GRCm38) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,500,817 (GRCm38) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,478,797 (GRCm38) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,492,805 (GRCm38) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,498,627 (GRCm38) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,548,990 (GRCm38) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,491,658 (GRCm38) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,500,796 (GRCm38) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,548,990 (GRCm38) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,435,304 (GRCm38) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,498,685 (GRCm38) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,451,318 (GRCm38) nonsense probably null
R7764:Dnah2 UTSW 11 69,458,158 (GRCm38) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,495,214 (GRCm38) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,516,593 (GRCm38) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,431,238 (GRCm38) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,518,428 (GRCm38) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,421,148 (GRCm38) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,520,834 (GRCm38) missense probably benign
R7928:Dnah2 UTSW 11 69,430,835 (GRCm38) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,517,685 (GRCm38) nonsense probably null
R7995:Dnah2 UTSW 11 69,520,737 (GRCm38) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,478,823 (GRCm38) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,520,852 (GRCm38) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,435,367 (GRCm38) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,475,573 (GRCm38) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,487,296 (GRCm38) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,429,447 (GRCm38) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,458,463 (GRCm38) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,459,278 (GRCm38) missense probably benign 0.00
R8673:Dnah2 UTSW 11 69,514,697 (GRCm38) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,524,179 (GRCm38) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,524,179 (GRCm38) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,493,261 (GRCm38) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,465,685 (GRCm38) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,491,522 (GRCm38) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,492,222 (GRCm38) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,437,928 (GRCm38) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,529,421 (GRCm38) missense probably benign
R9085:Dnah2 UTSW 11 69,429,398 (GRCm38) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,544,382 (GRCm38) missense probably benign
R9156:Dnah2 UTSW 11 69,422,861 (GRCm38) missense
R9251:Dnah2 UTSW 11 69,515,793 (GRCm38) missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69,477,253 (GRCm38) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,518,278 (GRCm38) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,484,329 (GRCm38) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,448,113 (GRCm38) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,493,247 (GRCm38) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,515,766 (GRCm38) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,436,164 (GRCm38) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,478,116 (GRCm38) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,473,394 (GRCm38) missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69,431,070 (GRCm38) missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69,515,791 (GRCm38) missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69,454,382 (GRCm38) missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69,477,215 (GRCm38) missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69,454,062 (GRCm38) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,450,998 (GRCm38) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,452,937 (GRCm38) missense probably benign
RF004:Dnah2 UTSW 11 69,437,187 (GRCm38) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,483,822 (GRCm38) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,448,562 (GRCm38) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,430,793 (GRCm38) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,421,821 (GRCm38) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,516,523 (GRCm38) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,516,481 (GRCm38) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,498,667 (GRCm38) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,487,054 (GRCm38) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,451,120 (GRCm38) missense probably benign
Z1177:Dnah2 UTSW 11 69,544,557 (GRCm38) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,463,453 (GRCm38) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTGGTGGTTAGCTAGGAAAACC -3'
(R):5'- GCAAACAGGAGTTCCGAGAC -3'

Sequencing Primer
(F):5'- TGGTTAGCTAGGAAAACCAAAGAACC -3'
(R):5'- AGACGGTAAGGCTGGGTTCC -3'
Posted On 2021-01-18