Incidental Mutation 'R8493:Card14'
ID658142
Institutional Source Beutler Lab
Gene Symbol Card14
Ensembl Gene ENSMUSG00000013483
Gene Namecaspase recruitment domain family, member 14
SynonymsBimp2, CARMA2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8493 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119307768-119345375 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 119333609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053245] [ENSMUST00000106250]
Predicted Effect probably null
Transcript: ENSMUST00000053245
SMART Domains Protein: ENSMUSP00000053665
Gene: ENSMUSG00000013483

DomainStartEndE-ValueType
Pfam:CARD 20 106 4.1e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106250
SMART Domains Protein: ENSMUSP00000101857
Gene: ENSMUSG00000013483

DomainStartEndE-ValueType
Pfam:CARD 20 106 2.8e-25 PFAM
coiled coil region 126 173 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
coiled coil region 280 377 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 473 483 N/A INTRINSIC
low complexity region 541 551 N/A INTRINSIC
PDZ 578 657 5.51e-3 SMART
Blast:SH3 676 735 4e-25 BLAST
low complexity region 736 746 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Blast:GuKc 826 989 4e-63 BLAST
SCOP:d1kjwa2 855 994 2e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 M1L unknown Het
4933402N22Rik T C 5: 11,921,522 L147P probably damaging Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 E125* probably null Het
Apob A T 12: 8,009,009 D2497V possibly damaging Het
Arap1 G A 7: 101,386,518 W87* probably null Het
Arhgef37 C T 18: 61,507,206 V261I probably benign Het
Arl4a A C 12: 40,036,473 C92G probably benign Het
Arrdc2 C T 8: 70,836,857 probably null Het
Atg16l1 A C 1: 87,778,982 T355P probably damaging Het
Cd109 G A 9: 78,657,519 V249I probably benign Het
Cdhr4 A G 9: 107,996,254 D395G probably damaging Het
Celsr1 C A 15: 85,938,006 M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 I277T probably benign Het
Chst4 A G 8: 110,030,463 V173A probably damaging Het
Clca4b T C 3: 144,912,150 N731D probably benign Het
Col11a2 A G 17: 34,059,962 E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 P341A probably damaging Het
Dclk3 A G 9: 111,468,147 E253G probably benign Het
Dnah2 T A 11: 69,452,978 D2829V probably damaging Het
Dnah7a T C 1: 53,472,908 N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 probably benign Het
Eprs A T 1: 185,407,174 K919* probably null Het
Esp16 A T 17: 39,539,930 K67* probably null Het
Fam169a G T 13: 97,122,859 E474D probably benign Het
Fam83h C T 15: 76,002,653 R945H probably benign Het
Flnb T A 14: 7,869,822 V195E probably damaging Het
Gm3159 T C 14: 4,398,567 I86T probably damaging Het
Gm3259 C T 5: 95,340,233 H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 S1655P probably benign Het
Gm4744 G A 6: 40,949,347 S103F Het
Ift122 T A 6: 115,910,331 I713N probably benign Het
Ilkap A G 1: 91,378,544 I105T probably damaging Het
Isl1 G T 13: 116,305,299 H133N possibly damaging Het
Jade1 T A 3: 41,604,678 L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 V195M probably benign Het
Kif3a A T 11: 53,598,800 K669* probably null Het
L3mbtl4 G A 17: 68,630,244 R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Naxe A G 3: 88,058,450 probably benign Het
Ndufs2 T C 1: 171,241,108 T51A probably benign Het
Nlrc5 T A 8: 94,523,220 L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 V27A unknown Het
Nucks1 A T 1: 131,929,735 M169L probably benign Het
Olfr1115 T A 2: 87,252,871 D311E probably benign Het
Olfr1128 T A 2: 87,544,770 Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 H155L probably damaging Het
Olfr1342 C T 4: 118,690,032 S140N probably benign Het
Olfr612 A T 7: 103,538,272 S321T probably benign Het
Olfr659 G T 7: 104,670,815 V38L probably benign Het
Pcnt C T 10: 76,403,623 probably null Het
Pdcd7 T C 9: 65,346,757 S206P probably benign Het
Pdia4 A T 6: 47,796,641 Y591* probably null Het
Plxna4 C T 6: 32,215,712 M771I probably benign Het
Ptpn13 A G 5: 103,564,165 Y1643C probably damaging Het
Ptpn13 A G 5: 103,569,805 I1906V probably benign Het
Rab33b T A 3: 51,484,374 S15T probably benign Het
Rasip1 A T 7: 45,635,043 M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 C55Y probably damaging Het
Sel1l A T 12: 91,813,961 Y585* probably null Het
Slc40a1 A T 1: 45,911,416 F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 D716N probably damaging Het
Sp7 T A 15: 102,358,402 H323L possibly damaging Het
Sprtn A G 8: 124,903,194 S409G probably benign Het
St3gal2 T G 8: 110,962,221 L131R probably damaging Het
Tctn1 A G 5: 122,261,489 C91R probably damaging Het
Tgm1 A T 14: 55,700,297 V785E probably damaging Het
Tmem8 G T 17: 26,121,957 R678L probably damaging Het
Topaz1 G T 9: 122,750,508 V828L probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 probably null Het
Usp2 G A 9: 44,076,053 G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 D580G probably benign Het
Wbp1l G A 19: 46,652,549 R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 C497F probably damaging Het
Other mutations in Card14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Card14 APN 11 119343145 missense probably benign 0.10
IGL02070:Card14 APN 11 119344704 missense probably damaging 1.00
IGL02632:Card14 APN 11 119338904 missense probably benign 0.02
R0183:Card14 UTSW 11 119326698 missense probably damaging 1.00
R0614:Card14 UTSW 11 119322827 missense probably benign
R0766:Card14 UTSW 11 119324176 missense probably damaging 1.00
R1033:Card14 UTSW 11 119338370 missense probably damaging 1.00
R1705:Card14 UTSW 11 119338406 missense possibly damaging 0.77
R1907:Card14 UTSW 11 119331259 missense probably benign 0.00
R1992:Card14 UTSW 11 119321821 critical splice acceptor site probably null
R3729:Card14 UTSW 11 119333932 missense probably damaging 1.00
R4472:Card14 UTSW 11 119333958 missense possibly damaging 0.77
R4578:Card14 UTSW 11 119326741 missense probably benign 0.20
R4763:Card14 UTSW 11 119343175 missense probably damaging 0.99
R5117:Card14 UTSW 11 119338250 missense probably damaging 0.99
R5386:Card14 UTSW 11 119317289 missense probably damaging 1.00
R6457:Card14 UTSW 11 119339602 nonsense probably null
R6622:Card14 UTSW 11 119333988 missense probably benign 0.06
R6998:Card14 UTSW 11 119322899 missense probably damaging 1.00
R7269:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7304:Card14 UTSW 11 119337747 missense probably damaging 1.00
R7310:Card14 UTSW 11 119326179 missense probably null 1.00
R7612:Card14 UTSW 11 119333579 missense possibly damaging 0.52
R7689:Card14 UTSW 11 119325502 missense possibly damaging 0.66
R8181:Card14 UTSW 11 119321892 missense probably damaging 1.00
R8188:Card14 UTSW 11 119337797 missense probably damaging 1.00
R8499:Card14 UTSW 11 119331244 missense probably benign 0.10
R8924:Card14 UTSW 11 119326104 missense possibly damaging 0.89
Z1177:Card14 UTSW 11 119341061 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTTCAGGTGGGGCACAATG -3'
(R):5'- ACAACCTGAGCACAGAGGTC -3'

Sequencing Primer
(F):5'- AATGATGCAGGCAGCTCC -3'
(R):5'- TCGGAGGAACCCTAGATTCTG -3'
Posted On2021-01-18