Incidental Mutation 'R8493:Flnb'
ID 658150
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 067935-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7869822 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 195 (V195E)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: V195E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V195E

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,653,453 (GRCm39) M1L unknown Het
Abca13 T A 11: 9,460,668 (GRCm39) I4226N probably damaging Het
Ankrd10 C A 8: 11,678,518 (GRCm39) E125* probably null Het
Apob A T 12: 8,059,009 (GRCm39) D2497V possibly damaging Het
Arap1 G A 7: 101,035,725 (GRCm39) W87* probably null Het
Arhgef37 C T 18: 61,640,277 (GRCm39) V261I probably benign Het
Arl4a A C 12: 40,086,472 (GRCm39) C92G probably benign Het
Arrdc2 C T 8: 71,289,501 (GRCm39) probably null Het
Atg16l1 A C 1: 87,706,704 (GRCm39) T355P probably damaging Het
Card14 T G 11: 119,224,435 (GRCm39) probably null Het
Cd109 G A 9: 78,564,801 (GRCm39) V249I probably benign Het
Cdhr4 A G 9: 107,873,453 (GRCm39) D395G probably damaging Het
Celsr1 C A 15: 85,822,207 (GRCm39) M1703I possibly damaging Het
Cfap157 A G 2: 32,669,752 (GRCm39) I277T probably benign Het
Chst4 A G 8: 110,757,095 (GRCm39) V173A probably damaging Het
Clca4b T C 3: 144,617,911 (GRCm39) N731D probably benign Het
Col11a2 A G 17: 34,278,936 (GRCm39) E1122G possibly damaging Het
Csf1r C G 18: 61,247,954 (GRCm39) P341A probably damaging Het
Dclk3 A G 9: 111,297,215 (GRCm39) E253G probably benign Het
Dnah2 T A 11: 69,343,804 (GRCm39) D2829V probably damaging Het
Dnah7a T C 1: 53,512,067 (GRCm39) N2998S probably damaging Het
Ehbp1 C T 11: 22,235,842 (GRCm39) probably benign Het
Eprs1 A T 1: 185,139,371 (GRCm39) K919* probably null Het
Esp16 A T 17: 39,850,821 (GRCm39) K67* probably null Het
Fam169a G T 13: 97,259,367 (GRCm39) E474D probably benign Het
Fam83h C T 15: 75,874,502 (GRCm39) R945H probably benign Het
Gm3159 T C 14: 4,398,567 (GRCm38) I86T probably damaging Het
Gm4744 G A 6: 40,926,281 (GRCm39) S103F Het
Gvin2 A G 7: 105,548,088 (GRCm39) S1655P probably benign Het
Ift122 T A 6: 115,887,292 (GRCm39) I713N probably benign Het
Ilkap A G 1: 91,306,266 (GRCm39) I105T probably damaging Het
Isl1 G T 13: 116,441,835 (GRCm39) H133N possibly damaging Het
Jade1 T A 3: 41,559,113 (GRCm39) L398Q possibly damaging Het
Kcnh7 C T 2: 62,681,003 (GRCm39) V195M probably benign Het
Kif3a A T 11: 53,489,627 (GRCm39) K669* probably null Het
L3mbtl4 G A 17: 68,937,239 (GRCm39) R420H probably damaging Het
Mrgprb1 A T 7: 48,097,321 (GRCm39) I197N probably damaging Het
Mthfd1 A G 12: 76,340,929 (GRCm39) T263A probably damaging Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Naxe A G 3: 87,965,757 (GRCm39) probably benign Het
Ndufs2 T C 1: 171,068,677 (GRCm39) T51A probably benign Het
Nlrc5 T A 8: 95,249,848 (GRCm39) L1824Q probably damaging Het
Notch1 A G 2: 26,362,251 (GRCm39) V27A unknown Het
Nucks1 A T 1: 131,857,473 (GRCm39) M169L probably benign Het
Or10ag53 T A 2: 87,083,215 (GRCm39) D311E probably benign Het
Or13p4 C T 4: 118,547,229 (GRCm39) S140N probably benign Het
Or4a80 T A 2: 89,582,599 (GRCm39) Y191F probably benign Het
Or4k45 T A 2: 111,395,324 (GRCm39) H155L probably damaging Het
Or51aa2 A T 7: 103,187,479 (GRCm39) S321T probably benign Het
Or52n20 G T 7: 104,320,022 (GRCm39) V38L probably benign Het
Or5w10 T A 2: 87,375,114 (GRCm39) Y258F probably damaging Het
Pcnt C T 10: 76,239,457 (GRCm39) probably null Het
Pdcd7 T C 9: 65,254,039 (GRCm39) S206P probably benign Het
Pdia4 A T 6: 47,773,575 (GRCm39) Y591* probably null Het
Pgap6 G T 17: 26,340,931 (GRCm39) R678L probably damaging Het
Plxna4 C T 6: 32,192,647 (GRCm39) M771I probably benign Het
Pramel47 C T 5: 95,488,092 (GRCm39) H9Y possibly damaging Het
Ptpn13 A G 5: 103,712,031 (GRCm39) Y1643C probably damaging Het
Ptpn13 A G 5: 103,717,671 (GRCm39) I1906V probably benign Het
Rab33b T A 3: 51,391,795 (GRCm39) S15T probably benign Het
Rasip1 A T 7: 45,284,467 (GRCm39) M644L possibly damaging Het
Rnf4 G A 5: 34,506,035 (GRCm39) C55Y probably damaging Het
Sel1l A T 12: 91,780,735 (GRCm39) Y585* probably null Het
Slc40a1 A T 1: 45,950,576 (GRCm39) F292Y probably damaging Het
Smarca4 G A 9: 21,570,144 (GRCm39) D716N probably damaging Het
Sp7 T A 15: 102,266,837 (GRCm39) H323L possibly damaging Het
Speer1m T C 5: 11,971,489 (GRCm39) L147P probably damaging Het
Sprtn A G 8: 125,629,933 (GRCm39) S409G probably benign Het
St3gal2 T G 8: 111,688,853 (GRCm39) L131R probably damaging Het
Tctn1 A G 5: 122,399,552 (GRCm39) C91R probably damaging Het
Tgm1 A T 14: 55,937,754 (GRCm39) V785E probably damaging Het
Topaz1 G T 9: 122,579,573 (GRCm39) V828L probably benign Het
Triobp C T 15: 78,878,326 (GRCm39) H1750Y possibly damaging Het
Ttc27 G A 17: 75,050,047 (GRCm39) probably null Het
Usp2 G A 9: 43,987,350 (GRCm39) G216D possibly damaging Het
Vmn2r99 A G 17: 19,614,020 (GRCm39) D580G probably benign Het
Wbp1l G A 19: 46,640,988 (GRCm39) R106H possibly damaging Het
Zmym2 G T 14: 57,151,606 (GRCm39) C497F probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCCCTCCGATGTACAATTGG -3'
(R):5'- GCAAGACTCTTCAAAGGCTG -3'

Sequencing Primer
(F):5'- CCTCCGATGTACAATTGGTTAAGCTG -3'
(R):5'- AGGCCACAGTCTGACCTAG -3'
Posted On 2021-01-18