Incidental Mutation 'R8493:Tmem8'
ID658159
Institutional Source Beutler Lab
Gene Symbol Tmem8
Ensembl Gene ENSMUSG00000024180
Gene Nametransmembrane protein 8 (five membrane-spanning domains)
SynonymsM83
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8493 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26113316-26123254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26121957 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 678 (R678L)
Ref Sequence ENSEMBL: ENSMUSP00000025010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably damaging
Transcript: ENSMUST00000025010
AA Change: R678L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180
AA Change: R678L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000128597
AA Change: R147L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180
AA Change: R147L

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 M1L unknown Het
4933402N22Rik T C 5: 11,921,522 L147P probably damaging Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 E125* probably null Het
Apob A T 12: 8,009,009 D2497V possibly damaging Het
Arap1 G A 7: 101,386,518 W87* probably null Het
Arhgef37 C T 18: 61,507,206 V261I probably benign Het
Arl4a A C 12: 40,036,473 C92G probably benign Het
Arrdc2 C T 8: 70,836,857 probably null Het
Atg16l1 A C 1: 87,778,982 T355P probably damaging Het
Card14 T G 11: 119,333,609 probably null Het
Cd109 G A 9: 78,657,519 V249I probably benign Het
Cdhr4 A G 9: 107,996,254 D395G probably damaging Het
Celsr1 C A 15: 85,938,006 M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 I277T probably benign Het
Chst4 A G 8: 110,030,463 V173A probably damaging Het
Clca4b T C 3: 144,912,150 N731D probably benign Het
Col11a2 A G 17: 34,059,962 E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 P341A probably damaging Het
Dclk3 A G 9: 111,468,147 E253G probably benign Het
Dnah2 T A 11: 69,452,978 D2829V probably damaging Het
Dnah7a T C 1: 53,472,908 N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 probably benign Het
Eprs A T 1: 185,407,174 K919* probably null Het
Esp16 A T 17: 39,539,930 K67* probably null Het
Fam169a G T 13: 97,122,859 E474D probably benign Het
Fam83h C T 15: 76,002,653 R945H probably benign Het
Flnb T A 14: 7,869,822 V195E probably damaging Het
Gm3159 T C 14: 4,398,567 I86T probably damaging Het
Gm3259 C T 5: 95,340,233 H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 S1655P probably benign Het
Gm4744 G A 6: 40,949,347 S103F Het
Ift122 T A 6: 115,910,331 I713N probably benign Het
Ilkap A G 1: 91,378,544 I105T probably damaging Het
Isl1 G T 13: 116,305,299 H133N possibly damaging Het
Jade1 T A 3: 41,604,678 L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 V195M probably benign Het
Kif3a A T 11: 53,598,800 K669* probably null Het
L3mbtl4 G A 17: 68,630,244 R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Naxe A G 3: 88,058,450 probably benign Het
Ndufs2 T C 1: 171,241,108 T51A probably benign Het
Nlrc5 T A 8: 94,523,220 L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 V27A unknown Het
Nucks1 A T 1: 131,929,735 M169L probably benign Het
Olfr1115 T A 2: 87,252,871 D311E probably benign Het
Olfr1128 T A 2: 87,544,770 Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 H155L probably damaging Het
Olfr1342 C T 4: 118,690,032 S140N probably benign Het
Olfr612 A T 7: 103,538,272 S321T probably benign Het
Olfr659 G T 7: 104,670,815 V38L probably benign Het
Pcnt C T 10: 76,403,623 probably null Het
Pdcd7 T C 9: 65,346,757 S206P probably benign Het
Pdia4 A T 6: 47,796,641 Y591* probably null Het
Plxna4 C T 6: 32,215,712 M771I probably benign Het
Ptpn13 A G 5: 103,569,805 I1906V probably benign Het
Ptpn13 A G 5: 103,564,165 Y1643C probably damaging Het
Rab33b T A 3: 51,484,374 S15T probably benign Het
Rasip1 A T 7: 45,635,043 M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 C55Y probably damaging Het
Sel1l A T 12: 91,813,961 Y585* probably null Het
Slc40a1 A T 1: 45,911,416 F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 D716N probably damaging Het
Sp7 T A 15: 102,358,402 H323L possibly damaging Het
Sprtn A G 8: 124,903,194 S409G probably benign Het
St3gal2 T G 8: 110,962,221 L131R probably damaging Het
Tctn1 A G 5: 122,261,489 C91R probably damaging Het
Tgm1 A T 14: 55,700,297 V785E probably damaging Het
Topaz1 G T 9: 122,750,508 V828L probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 probably null Het
Usp2 G A 9: 44,076,053 G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 D580G probably benign Het
Wbp1l G A 19: 46,652,549 R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 C497F probably damaging Het
Other mutations in Tmem8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Tmem8 APN 17 26117519 missense probably damaging 0.96
IGL01014:Tmem8 APN 17 26117009 unclassified probably benign
IGL02167:Tmem8 APN 17 26119071 missense probably damaging 1.00
IGL02375:Tmem8 APN 17 26119499 missense probably benign 0.05
IGL02892:Tmem8 APN 17 26119120 missense probably damaging 1.00
IGL02931:Tmem8 APN 17 26117949 missense probably benign
IGL03005:Tmem8 APN 17 26118937 missense probably benign 0.01
IGL03124:Tmem8 APN 17 26116834 missense probably damaging 0.98
IGL03046:Tmem8 UTSW 17 26119440 splice site probably null
R0551:Tmem8 UTSW 17 26120602 missense probably damaging 1.00
R0555:Tmem8 UTSW 17 26117114 missense probably benign 0.19
R1502:Tmem8 UTSW 17 26120316 missense possibly damaging 0.82
R1593:Tmem8 UTSW 17 26118407 missense possibly damaging 0.63
R1688:Tmem8 UTSW 17 26118908 missense possibly damaging 0.94
R1829:Tmem8 UTSW 17 26122220 missense probably damaging 1.00
R2071:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R2117:Tmem8 UTSW 17 26117884 missense possibly damaging 0.67
R3609:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R3610:Tmem8 UTSW 17 26118886 missense probably benign 0.23
R4564:Tmem8 UTSW 17 26117863 missense possibly damaging 0.80
R4749:Tmem8 UTSW 17 26116783 missense probably damaging 1.00
R4777:Tmem8 UTSW 17 26121541 missense probably damaging 1.00
R4913:Tmem8 UTSW 17 26120539 missense probably damaging 1.00
R5098:Tmem8 UTSW 17 26118928 missense probably damaging 1.00
R5126:Tmem8 UTSW 17 26121640 missense probably damaging 0.99
R5640:Tmem8 UTSW 17 26118872 missense possibly damaging 0.50
R5722:Tmem8 UTSW 17 26120562 frame shift probably null
R5723:Tmem8 UTSW 17 26120562 frame shift probably null
R5739:Tmem8 UTSW 17 26120451 missense probably damaging 1.00
R5927:Tmem8 UTSW 17 26121998 missense probably benign 0.34
R6587:Tmem8 UTSW 17 26121564 missense probably benign 0.03
R6723:Tmem8 UTSW 17 26120636 missense probably damaging 0.96
R7588:Tmem8 UTSW 17 26122043 missense probably damaging 1.00
R7621:Tmem8 UTSW 17 26117891 missense probably benign 0.00
R7653:Tmem8 UTSW 17 26120449 missense probably damaging 1.00
R7771:Tmem8 UTSW 17 26122073 missense probably damaging 1.00
R8037:Tmem8 UTSW 17 26117535 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTAGCAGCTACCCATAGAGC -3'
(R):5'- GAACTTCTGCAAACAGGCCC -3'

Sequencing Primer
(F):5'- TACCCATAGAGCCCCAGTCTGG -3'
(R):5'- TCCTCTCGTGGTGGCAGAAG -3'
Posted On2021-01-18