Incidental Mutation 'R8494:Olfr1271'
ID658171
Institutional Source Beutler Lab
Gene Symbol Olfr1271
Ensembl Gene ENSMUSG00000075062
Gene Nameolfactory receptor 1271
SynonymsGA_x6K02T2Q125-51620802-51619885, MOR227-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8494 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90260546-90271032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90265536 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 298 (M298K)
Ref Sequence ENSEMBL: ENSMUSP00000097340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099751] [ENSMUST00000216383]
Predicted Effect probably null
Transcript: ENSMUST00000099751
AA Change: M298K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097340
Gene: ENSMUSG00000075062
AA Change: M298K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.1e-50 PFAM
Pfam:7tm_1 39 285 6.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216383
AA Change: M298K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217396
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,288,662 M1420L probably benign Het
Adamts14 T A 10: 61,202,929 H934L probably benign Het
Adamtsl1 T C 4: 86,321,984 C661R probably damaging Het
Akap5 A G 12: 76,329,681 D629G probably benign Het
Anapc16 A T 10: 59,996,518 probably benign Het
Ankar T C 1: 72,658,794 I758V probably benign Het
Apc2 G T 10: 80,314,479 R1760L probably damaging Het
C1qb T C 4: 136,880,804 T83A probably benign Het
Canx T A 11: 50,311,782 probably null Het
Cblb T A 16: 52,204,640 I966K probably damaging Het
Crocc2 A T 1: 93,217,066 Q1444L probably damaging Het
Dennd4c C T 4: 86,841,075 P1781S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah5 A C 15: 28,345,831 N2439T probably benign Het
Dsg3 T A 18: 20,540,214 Y981N probably benign Het
Esrp2 C T 8: 106,134,718 V150M probably damaging Het
Fbxo15 T G 18: 84,964,127 F235V probably damaging Het
Ffar2 A T 7: 30,819,739 Y125* probably null Het
Gm1110 T A 9: 26,880,858 D622V probably benign Het
Gpcpd1 A G 2: 132,544,435 V341A probably damaging Het
Gpx3 G A 11: 54,903,020 V19I probably benign Het
Hadha T C 5: 30,142,812 I160M probably damaging Het
Igkv3-4 G T 6: 70,672,163 V49F probably damaging Het
Kcng1 A G 2: 168,263,098 V276A probably damaging Het
Kif7 A T 7: 79,710,397 V364D probably benign Het
Kirrel3 A G 9: 34,991,045 I182V probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mcm9 G A 10: 53,625,760 T243M possibly damaging Het
Micall1 T C 15: 79,120,880 L184P probably damaging Het
Mief1 T A 15: 80,249,392 C217S probably benign Het
Mier2 T C 10: 79,541,712 D469G probably damaging Het
Mst1r T G 9: 107,914,519 W799G possibly damaging Het
Mybpc1 C T 10: 88,526,429 V950I probably benign Het
Neurl4 A G 11: 69,911,045 D1296G probably benign Het
Parg T A 14: 32,209,021 H199Q probably benign Het
Pcnx3 C A 19: 5,675,376 D1170Y probably damaging Het
Phactr1 T A 13: 43,096,668 V487E probably damaging Het
Selp T G 1: 164,130,266 probably null Het
Smpd3 T C 8: 106,255,350 E626G probably damaging Het
Syn3 A G 10: 86,354,401 L188P probably damaging Het
Tle1 T C 4: 72,125,004 I543V possibly damaging Het
Trp53rkb A G 2: 166,795,859 *245W probably null Het
Ttc28 A G 5: 111,235,640 R1336G probably damaging Het
Vps13b T A 15: 35,422,448 W185R probably damaging Het
Other mutations in Olfr1271
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1271 APN 2 90265951 missense probably damaging 0.97
IGL02901:Olfr1271 APN 2 90265708 missense probably damaging 1.00
PIT4466001:Olfr1271 UTSW 2 90266295 missense probably damaging 0.97
PIT4468001:Olfr1271 UTSW 2 90266220 missense probably benign 0.00
R0325:Olfr1271 UTSW 2 90265536 missense probably null
R1350:Olfr1271 UTSW 2 90266346 missense probably damaging 0.97
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R2509:Olfr1271 UTSW 2 90265686 missense possibly damaging 0.91
R2510:Olfr1271 UTSW 2 90265606 missense probably damaging 0.98
R4113:Olfr1271 UTSW 2 90266340 missense probably damaging 1.00
R5414:Olfr1271 UTSW 2 90265702 missense probably benign 0.07
R5580:Olfr1271 UTSW 2 90266350 missense probably benign 0.00
R5664:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R5666:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5670:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5881:Olfr1271 UTSW 2 90266442 splice site probably null
R6493:Olfr1271 UTSW 2 90265708 missense probably damaging 1.00
R7688:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R7719:Olfr1271 UTSW 2 90266259 missense probably damaging 1.00
R8041:Olfr1271 UTSW 2 90266144 nonsense probably null
R8220:Olfr1271 UTSW 2 90266043 missense probably benign 0.01
R8736:Olfr1271 UTSW 2 90265578 missense possibly damaging 0.52
R8861:Olfr1271 UTSW 2 90266459 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGACCACAGTAGAAGTTTC -3'
(R):5'- GTCATCCTAATCAGCTTGAGGAAG -3'

Sequencing Primer
(F):5'- GCAGACCACAGTAGAAGTTTCCTAAG -3'
(R):5'- AGACGGAAGGCCCTCTCTAC -3'
Posted On2021-01-18