Incidental Mutation 'R8494:Gm1110'
ID658187
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8494 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26880858 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 622 (D622V)
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect probably benign
Transcript: ENSMUST00000115261
AA Change: D622V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: D622V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,288,662 M1420L probably benign Het
Adamts14 T A 10: 61,202,929 H934L probably benign Het
Adamtsl1 T C 4: 86,321,984 C661R probably damaging Het
Akap5 A G 12: 76,329,681 D629G probably benign Het
Anapc16 A T 10: 59,996,518 probably benign Het
Ankar T C 1: 72,658,794 I758V probably benign Het
Apc2 G T 10: 80,314,479 R1760L probably damaging Het
C1qb T C 4: 136,880,804 T83A probably benign Het
Canx T A 11: 50,311,782 probably null Het
Cblb T A 16: 52,204,640 I966K probably damaging Het
Crocc2 A T 1: 93,217,066 Q1444L probably damaging Het
Dennd4c C T 4: 86,841,075 P1781S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah5 A C 15: 28,345,831 N2439T probably benign Het
Dsg3 T A 18: 20,540,214 Y981N probably benign Het
Esrp2 C T 8: 106,134,718 V150M probably damaging Het
Fbxo15 T G 18: 84,964,127 F235V probably damaging Het
Ffar2 A T 7: 30,819,739 Y125* probably null Het
Gpcpd1 A G 2: 132,544,435 V341A probably damaging Het
Gpx3 G A 11: 54,903,020 V19I probably benign Het
Hadha T C 5: 30,142,812 I160M probably damaging Het
Igkv3-4 G T 6: 70,672,163 V49F probably damaging Het
Kcng1 A G 2: 168,263,098 V276A probably damaging Het
Kif7 A T 7: 79,710,397 V364D probably benign Het
Kirrel3 A G 9: 34,991,045 I182V probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mcm9 G A 10: 53,625,760 T243M possibly damaging Het
Micall1 T C 15: 79,120,880 L184P probably damaging Het
Mief1 T A 15: 80,249,392 C217S probably benign Het
Mier2 T C 10: 79,541,712 D469G probably damaging Het
Mst1r T G 9: 107,914,519 W799G possibly damaging Het
Mybpc1 C T 10: 88,526,429 V950I probably benign Het
Neurl4 A G 11: 69,911,045 D1296G probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Parg T A 14: 32,209,021 H199Q probably benign Het
Pcnx3 C A 19: 5,675,376 D1170Y probably damaging Het
Phactr1 T A 13: 43,096,668 V487E probably damaging Het
Selp T G 1: 164,130,266 probably null Het
Smpd3 T C 8: 106,255,350 E626G probably damaging Het
Syn3 A G 10: 86,354,401 L188P probably damaging Het
Tle1 T C 4: 72,125,004 I543V possibly damaging Het
Trp53rkb A G 2: 166,795,859 *245W probably null Het
Ttc28 A G 5: 111,235,640 R1336G probably damaging Het
Vps13b T A 15: 35,422,448 W185R probably damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0189:Gm1110 UTSW 9 26883218 missense probably null 0.99
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2567:Gm1110 UTSW 9 26920696 missense probably benign
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4271:Gm1110 UTSW 9 26895648 critical splice donor site probably null
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5239:Gm1110 UTSW 9 26893570 missense probably benign 0.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 splice site probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7579:Gm1110 UTSW 9 26883826 missense possibly damaging 0.93
R7990:Gm1110 UTSW 9 26880841 missense possibly damaging 0.66
R8062:Gm1110 UTSW 9 26881821 missense probably damaging 0.99
R8108:Gm1110 UTSW 9 26920661 missense probably damaging 1.00
R8323:Gm1110 UTSW 9 26902423 critical splice donor site probably null
R8354:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8354:Gm1110 UTSW 9 26883281 missense probably benign 0.00
R8454:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8454:Gm1110 UTSW 9 26883281 missense probably benign 0.00
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAACACAGTGGGACCATCAG -3'
(R):5'- GAAACTGTCTTTGTCCCTGGC -3'

Sequencing Primer
(F):5'- CAAGCAGATTTCTGAGTTCAAGGCC -3'
(R):5'- GGCTCCTGGCTTCAACCTG -3'
Posted On2021-01-18