Incidental Mutation 'R8494:Mst1r'
ID658189
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R8494 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107914519 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 799 (W799G)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035203
AA Change: W799G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: W799G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,288,662 M1420L probably benign Het
Adamts14 T A 10: 61,202,929 H934L probably benign Het
Adamtsl1 T C 4: 86,321,984 C661R probably damaging Het
Akap5 A G 12: 76,329,681 D629G probably benign Het
Anapc16 A T 10: 59,996,518 probably benign Het
Ankar T C 1: 72,658,794 I758V probably benign Het
Apc2 G T 10: 80,314,479 R1760L probably damaging Het
C1qb T C 4: 136,880,804 T83A probably benign Het
Canx T A 11: 50,311,782 probably null Het
Cblb T A 16: 52,204,640 I966K probably damaging Het
Crocc2 A T 1: 93,217,066 Q1444L probably damaging Het
Dennd4c C T 4: 86,841,075 P1781S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah5 A C 15: 28,345,831 N2439T probably benign Het
Dsg3 T A 18: 20,540,214 Y981N probably benign Het
Esrp2 C T 8: 106,134,718 V150M probably damaging Het
Fbxo15 T G 18: 84,964,127 F235V probably damaging Het
Ffar2 A T 7: 30,819,739 Y125* probably null Het
Gm1110 T A 9: 26,880,858 D622V probably benign Het
Gpcpd1 A G 2: 132,544,435 V341A probably damaging Het
Gpx3 G A 11: 54,903,020 V19I probably benign Het
Hadha T C 5: 30,142,812 I160M probably damaging Het
Igkv3-4 G T 6: 70,672,163 V49F probably damaging Het
Kcng1 A G 2: 168,263,098 V276A probably damaging Het
Kif7 A T 7: 79,710,397 V364D probably benign Het
Kirrel3 A G 9: 34,991,045 I182V probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mcm9 G A 10: 53,625,760 T243M possibly damaging Het
Micall1 T C 15: 79,120,880 L184P probably damaging Het
Mief1 T A 15: 80,249,392 C217S probably benign Het
Mier2 T C 10: 79,541,712 D469G probably damaging Het
Mybpc1 C T 10: 88,526,429 V950I probably benign Het
Neurl4 A G 11: 69,911,045 D1296G probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Parg T A 14: 32,209,021 H199Q probably benign Het
Pcnx3 C A 19: 5,675,376 D1170Y probably damaging Het
Phactr1 T A 13: 43,096,668 V487E probably damaging Het
Selp T G 1: 164,130,266 probably null Het
Smpd3 T C 8: 106,255,350 E626G probably damaging Het
Syn3 A G 10: 86,354,401 L188P probably damaging Het
Tle1 T C 4: 72,125,004 I543V possibly damaging Het
Trp53rkb A G 2: 166,795,859 *245W probably null Het
Ttc28 A G 5: 111,235,640 R1336G probably damaging Het
Vps13b T A 15: 35,422,448 W185R probably damaging Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107915122 missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107920012 missense probably benign 0.05
R7684:Mst1r UTSW 9 107911563 missense probably benign 0.01
R7741:Mst1r UTSW 9 107907120 start gained probably benign
R7916:Mst1r UTSW 9 107907578 missense probably damaging 1.00
R7987:Mst1r UTSW 9 107912798 splice site probably null
R8177:Mst1r UTSW 9 107907585 missense probably damaging 1.00
R8356:Mst1r UTSW 9 107917264 missense probably damaging 1.00
R8692:Mst1r UTSW 9 107914851 missense possibly damaging 0.82
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACCCTATTGTGTTGGACATC -3'
(R):5'- GCTGTTGTTCCACAAACTGCC -3'

Sequencing Primer
(F):5'- ATCAGTCCCAAGTGTGGCTACAG -3'
(R):5'- ACACTGCTGAGACCCATGG -3'
Posted On2021-01-18