Incidental Mutation 'R8494:Canx'
ID658197
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Namecalnexin
Synonyms1110069N15Rik, CNX
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R8494 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50293961-50325673 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 50311782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]
Predicted Effect probably benign
Transcript: ENSMUST00000020637
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179865
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,288,662 M1420L probably benign Het
Adamts14 T A 10: 61,202,929 H934L probably benign Het
Adamtsl1 T C 4: 86,321,984 C661R probably damaging Het
Akap5 A G 12: 76,329,681 D629G probably benign Het
Anapc16 A T 10: 59,996,518 probably benign Het
Ankar T C 1: 72,658,794 I758V probably benign Het
Apc2 G T 10: 80,314,479 R1760L probably damaging Het
C1qb T C 4: 136,880,804 T83A probably benign Het
Cblb T A 16: 52,204,640 I966K probably damaging Het
Crocc2 A T 1: 93,217,066 Q1444L probably damaging Het
Dennd4c C T 4: 86,841,075 P1781S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah5 A C 15: 28,345,831 N2439T probably benign Het
Dsg3 T A 18: 20,540,214 Y981N probably benign Het
Esrp2 C T 8: 106,134,718 V150M probably damaging Het
Fbxo15 T G 18: 84,964,127 F235V probably damaging Het
Ffar2 A T 7: 30,819,739 Y125* probably null Het
Gm1110 T A 9: 26,880,858 D622V probably benign Het
Gpcpd1 A G 2: 132,544,435 V341A probably damaging Het
Gpx3 G A 11: 54,903,020 V19I probably benign Het
Hadha T C 5: 30,142,812 I160M probably damaging Het
Igkv3-4 G T 6: 70,672,163 V49F probably damaging Het
Kcng1 A G 2: 168,263,098 V276A probably damaging Het
Kif7 A T 7: 79,710,397 V364D probably benign Het
Kirrel3 A G 9: 34,991,045 I182V probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mcm9 G A 10: 53,625,760 T243M possibly damaging Het
Micall1 T C 15: 79,120,880 L184P probably damaging Het
Mief1 T A 15: 80,249,392 C217S probably benign Het
Mier2 T C 10: 79,541,712 D469G probably damaging Het
Mst1r T G 9: 107,914,519 W799G possibly damaging Het
Mybpc1 C T 10: 88,526,429 V950I probably benign Het
Neurl4 A G 11: 69,911,045 D1296G probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Parg T A 14: 32,209,021 H199Q probably benign Het
Pcnx3 C A 19: 5,675,376 D1170Y probably damaging Het
Phactr1 T A 13: 43,096,668 V487E probably damaging Het
Selp T G 1: 164,130,266 probably null Het
Smpd3 T C 8: 106,255,350 E626G probably damaging Het
Syn3 A G 10: 86,354,401 L188P probably damaging Het
Tle1 T C 4: 72,125,004 I543V possibly damaging Het
Trp53rkb A G 2: 166,795,859 *245W probably null Het
Ttc28 A G 5: 111,235,640 R1336G probably damaging Het
Vps13b T A 15: 35,422,448 W185R probably damaging Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1428:Canx UTSW 11 50308394 splice site probably benign
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2217:Canx UTSW 11 50310867 missense probably benign 0.24
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R2386:Canx UTSW 11 50297106 missense probably benign
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5797:Canx UTSW 11 50301017 missense probably benign 0.00
R5820:Canx UTSW 11 50308383 missense probably damaging 1.00
R6052:Canx UTSW 11 50297119 missense possibly damaging 0.49
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
R7603:Canx UTSW 11 50311628 missense probably benign
R7715:Canx UTSW 11 50310804 missense probably benign 0.13
R7735:Canx UTSW 11 50301039 missense probably damaging 0.97
R8063:Canx UTSW 11 50308346 nonsense probably null
R8069:Canx UTSW 11 50311704 missense possibly damaging 0.93
R8508:Canx UTSW 11 50311647 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACTGATCTGCTTCAAACCTTTG -3'
(R):5'- GGGAAACAGTACATTTCACATTCC -3'

Sequencing Primer
(F):5'- TTCAAACCTTTGGAGATGGAGG -3'
(R):5'- TGAGACAGGGTTTCTCTG -3'
Posted On2021-01-18