Incidental Mutation 'R8494:Cblb'
ID 658208
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene Name Casitas B-lineage lymphoma b
Synonyms Cbl-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock # R8494 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 52031225-52208048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52204640 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 966 (I966K)
Ref Sequence ENSEMBL: ENSMUSP00000153787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]
AlphaFold Q3TTA7
Predicted Effect probably damaging
Transcript: ENSMUST00000114471
AA Change: I922K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: I922K

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226593
AA Change: I966K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227062
AA Change: I922K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227756
AA Change: I814K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227879
AA Change: I966K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,288,662 M1420L probably benign Het
Adamts14 T A 10: 61,202,929 H934L probably benign Het
Adamtsl1 T C 4: 86,321,984 C661R probably damaging Het
Akap5 A G 12: 76,329,681 D629G probably benign Het
Anapc16 A T 10: 59,996,518 probably benign Het
Ankar T C 1: 72,658,794 I758V probably benign Het
Apc2 G T 10: 80,314,479 R1760L probably damaging Het
C1qb T C 4: 136,880,804 T83A probably benign Het
Canx T A 11: 50,311,782 probably null Het
Crocc2 A T 1: 93,217,066 Q1444L probably damaging Het
Dennd4c C T 4: 86,841,075 P1781S probably damaging Het
Diaph3 T C 14: 87,037,522 Y166C probably benign Het
Dnah5 A C 15: 28,345,831 N2439T probably benign Het
Dsg3 T A 18: 20,540,214 Y981N probably benign Het
Esrp2 C T 8: 106,134,718 V150M probably damaging Het
Fbxo15 T G 18: 84,964,127 F235V probably damaging Het
Ffar2 A T 7: 30,819,739 Y125* probably null Het
Gm1110 T A 9: 26,880,858 D622V probably benign Het
Gpcpd1 A G 2: 132,544,435 V341A probably damaging Het
Gpx3 G A 11: 54,903,020 V19I probably benign Het
Hadha T C 5: 30,142,812 I160M probably damaging Het
Igkv3-4 G T 6: 70,672,163 V49F probably damaging Het
Kcng1 A G 2: 168,263,098 V276A probably damaging Het
Kif7 A T 7: 79,710,397 V364D probably benign Het
Kirrel3 A G 9: 34,991,045 I182V probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mcm9 G A 10: 53,625,760 T243M possibly damaging Het
Micall1 T C 15: 79,120,880 L184P probably damaging Het
Mief1 T A 15: 80,249,392 C217S probably benign Het
Mier2 T C 10: 79,541,712 D469G probably damaging Het
Mst1r T G 9: 107,914,519 W799G possibly damaging Het
Mybpc1 C T 10: 88,526,429 V950I probably benign Het
Neurl4 A G 11: 69,911,045 D1296G probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Parg T A 14: 32,209,021 H199Q probably benign Het
Pcnx3 C A 19: 5,675,376 D1170Y probably damaging Het
Phactr1 T A 13: 43,096,668 V487E probably damaging Het
Selp T G 1: 164,130,266 probably null Het
Smpd3 T C 8: 106,255,350 E626G probably damaging Het
Syn3 A G 10: 86,354,401 L188P probably damaging Het
Tle1 T C 4: 72,125,004 I543V possibly damaging Het
Trp53rkb A G 2: 166,795,859 *245W probably null Het
Ttc28 A G 5: 111,235,640 R1336G probably damaging Het
Vps13b T A 15: 35,422,448 W185R probably damaging Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
R7681:Cblb UTSW 16 52204638 missense probably damaging 0.96
R7940:Cblb UTSW 16 52152536 missense probably damaging 1.00
R8167:Cblb UTSW 16 52166002 missense probably benign 0.13
R8236:Cblb UTSW 16 52166029 missense possibly damaging 0.85
R8880:Cblb UTSW 16 52166005 missense probably benign
R9308:Cblb UTSW 16 52189011 critical splice acceptor site probably null
R9386:Cblb UTSW 16 52166338 nonsense probably null
R9387:Cblb UTSW 16 52033152 missense probably benign 0.12
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATGGTTCGCAAGCACCAG -3'
(R):5'- CTGTGGAACCAGAGAAGCTG -3'

Sequencing Primer
(F):5'- GCACCAGCTAGACCCCC -3'
(R):5'- TGGACTCCAGGCTGCCTTC -3'
Posted On 2021-01-18