Mutagenetix > Incidental Mutations

Incidental Mutation 'R8494:Cblb'

658208

Institutional Source

Beutler Lab

Gene Symbol

Cblb

Ensembl Gene

ENSMUSG00000022637

Gene Name

Casitas B-lineage lymphoma b

Synonyms

Cbl-b

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R8494 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52031225-52208048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52204640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 966 (I966K)

Ref Sequence

ENSEMBL: ENSMUSP00000153787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]

AlphaFold

Q3TTA7

Predicted Effect

probably damaging
Transcript: ENSMUST00000114471
AA Change: I922K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: I922K

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
Pfam:Cbl_N	41	167	1.5e-58	PFAM
Pfam:Cbl_N2	171	254	2.9e-43	PFAM
SH2	257	354	3.22e0	SMART
RING	373	411	1.04e-7	SMART
low complexity region	447	454	N/A	INTRINSIC
low complexity region	543	567	N/A	INTRINSIC
low complexity region	666	682	N/A	INTRINSIC
low complexity region	773	783	N/A	INTRINSIC
low complexity region	792	804	N/A	INTRINSIC
low complexity region	857	871	N/A	INTRINSIC
UBA	888	925	4.06e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226593
AA Change: I966K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227062
AA Change: I922K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227756
AA Change: I814K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227879
AA Change: I966K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,288,662	M1420L	probably benign	Het
Adamts14	T	A	10: 61,202,929	H934L	probably benign	Het
Adamtsl1	T	C	4: 86,321,984	C661R	probably damaging	Het
Akap5	A	G	12: 76,329,681	D629G	probably benign	Het
Anapc16	A	T	10: 59,996,518		probably benign	Het
Ankar	T	C	1: 72,658,794	I758V	probably benign	Het
Apc2	G	T	10: 80,314,479	R1760L	probably damaging	Het
C1qb	T	C	4: 136,880,804	T83A	probably benign	Het
Canx	T	A	11: 50,311,782		probably null	Het
Crocc2	A	T	1: 93,217,066	Q1444L	probably damaging	Het
Dennd4c	C	T	4: 86,841,075	P1781S	probably damaging	Het
Diaph3	T	C	14: 87,037,522	Y166C	probably benign	Het
Dnah5	A	C	15: 28,345,831	N2439T	probably benign	Het
Dsg3	T	A	18: 20,540,214	Y981N	probably benign	Het
Esrp2	C	T	8: 106,134,718	V150M	probably damaging	Het
Fbxo15	T	G	18: 84,964,127	F235V	probably damaging	Het
Ffar2	A	T	7: 30,819,739	Y125*	probably null	Het
Gm1110	T	A	9: 26,880,858	D622V	probably benign	Het
Gpcpd1	A	G	2: 132,544,435	V341A	probably damaging	Het
Gpx3	G	A	11: 54,903,020	V19I	probably benign	Het
Hadha	T	C	5: 30,142,812	I160M	probably damaging	Het
Igkv3-4	G	T	6: 70,672,163	V49F	probably damaging	Het
Kcng1	A	G	2: 168,263,098	V276A	probably damaging	Het
Kif7	A	T	7: 79,710,397	V364D	probably benign	Het
Kirrel3	A	G	9: 34,991,045	I182V	probably benign	Het
Lfng	G	A	5: 140,613,226	E297K	probably damaging	Het
Mcm9	G	A	10: 53,625,760	T243M	possibly damaging	Het
Micall1	T	C	15: 79,120,880	L184P	probably damaging	Het
Mief1	T	A	15: 80,249,392	C217S	probably benign	Het
Mier2	T	C	10: 79,541,712	D469G	probably damaging	Het
Mst1r	T	G	9: 107,914,519	W799G	possibly damaging	Het
Mybpc1	C	T	10: 88,526,429	V950I	probably benign	Het
Neurl4	A	G	11: 69,911,045	D1296G	probably benign	Het
Olfr1271	A	T	2: 90,265,536	M298K	probably null	Het
Parg	T	A	14: 32,209,021	H199Q	probably benign	Het
Pcnx3	C	A	19: 5,675,376	D1170Y	probably damaging	Het
Phactr1	T	A	13: 43,096,668	V487E	probably damaging	Het
Selp	T	G	1: 164,130,266		probably null	Het
Smpd3	T	C	8: 106,255,350	E626G	probably damaging	Het
Syn3	A	G	10: 86,354,401	L188P	probably damaging	Het
Tle1	T	C	4: 72,125,004	I543V	possibly damaging	Het
Trp53rkb	A	G	2: 166,795,859	*245W	probably null	Het
Ttc28	A	G	5: 111,235,640	R1336G	probably damaging	Het
Vps13b	T	A	15: 35,422,448	W185R	probably damaging	Het

Other mutations in Cblb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Cblb	APN	16	52183307	missense	probably benign	0.28
IGL00927:Cblb	APN	16	52166098	missense	probably benign
IGL01108:Cblb	APN	16	52047451	critical splice donor site	probably null
IGL01336:Cblb	APN	16	52186229	missense	probably benign	0.00
IGL01943:Cblb	APN	16	52139633	splice site	probably null
IGL02273:Cblb	APN	16	52047294	missense	possibly damaging	0.95
IGL02405:Cblb	APN	16	52166253	missense	probably benign	0.32
IGL02445:Cblb	APN	16	52166305	missense	probably damaging	1.00
IGL02728:Cblb	APN	16	52183309	missense	probably benign	0.04
IGL03000:Cblb	APN	16	52204542	missense	probably damaging	1.00
PIT4362001:Cblb	UTSW	16	52139542	nonsense	probably null
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0294:Cblb	UTSW	16	52135824	missense	probably damaging	1.00
R0403:Cblb	UTSW	16	52152626	missense	probably benign	0.23
R0506:Cblb	UTSW	16	52204480	missense	probably benign	0.25
R1172:Cblb	UTSW	16	52186240	splice site	probably benign
R1245:Cblb	UTSW	16	52047187	splice site	probably benign
R1443:Cblb	UTSW	16	52139611	missense	possibly damaging	0.95
R1549:Cblb	UTSW	16	52033010	splice site	probably benign
R1568:Cblb	UTSW	16	52135829	missense	probably damaging	1.00
R1734:Cblb	UTSW	16	52186240	splice site	probably benign
R2107:Cblb	UTSW	16	52152716	critical splice donor site	probably null
R2231:Cblb	UTSW	16	52194272	missense	probably benign	0.00
R4419:Cblb	UTSW	16	52047258	missense	possibly damaging	0.80
R4913:Cblb	UTSW	16	52166029	missense	possibly damaging	0.78
R4940:Cblb	UTSW	16	52033103	missense	probably damaging	1.00
R5159:Cblb	UTSW	16	52112120	missense	probably damaging	0.97
R5318:Cblb	UTSW	16	52186198	missense	possibly damaging	0.88
R5367:Cblb	UTSW	16	52204653	missense	probably damaging	1.00
R5432:Cblb	UTSW	16	52142865	missense	probably damaging	1.00
R5490:Cblb	UTSW	16	52174370	missense	possibly damaging	0.52
R5618:Cblb	UTSW	16	52152668	missense	possibly damaging	0.89
R6047:Cblb	UTSW	16	52112248	critical splice donor site	probably null
R6152:Cblb	UTSW	16	52141056	missense	probably damaging	0.98
R6667:Cblb	UTSW	16	52152644	missense	possibly damaging	0.81
R6914:Cblb	UTSW	16	52047430	missense	probably damaging	1.00
R7681:Cblb	UTSW	16	52204638	missense	probably damaging	0.96
R7940:Cblb	UTSW	16	52152536	missense	probably damaging	1.00
R8167:Cblb	UTSW	16	52166002	missense	probably benign	0.13
R8236:Cblb	UTSW	16	52166029	missense	possibly damaging	0.85
R8880:Cblb	UTSW	16	52166005	missense	probably benign
R9308:Cblb	UTSW	16	52189011	critical splice acceptor site	probably null
R9386:Cblb	UTSW	16	52166338	nonsense	probably null
R9387:Cblb	UTSW	16	52033152	missense	probably benign	0.12
X0011:Cblb	UTSW	16	52152629	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGATGGTTCGCAAGCACCAG -3'
(R):5'- CTGTGGAACCAGAGAAGCTG -3'

Sequencing Primer
(F):5'- GCACCAGCTAGACCCCC -3'
(R):5'- TGGACTCCAGGCTGCCTTC -3'

Posted On

2021-01-18